Variant NM_000492.4:c.2657+5G>A


Variant details:
Name NM_000492.4:c.2657+5G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117242922G>A    UCSC    
#Exon/intron intron 16
Legacy Name 2789+5G>A
Class disease-causing
Subclass varying clinical consequence
WT sequence TGTGCTGTGGCTCCTTGGAAAGTGA G TATTCCATGTCCTATTGTGTAGATT
Mutant sequence TGTGCTGTGGCTCCTTGGAAAGTGA A TATTCCATGTCCTATTGTGTAGATT

Other databases:
dbSNP
rs80224560







Pathogenicity predictors:

Not found



Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVAnononono


clinical and functional data are provided by Vertex


No patient found in CFTR-NGS catalogue


125 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 125
CF 70
CFTR-RD35
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  5
  • CBAVD  16
  • CRS-NP  2
  • Other  7
  • Pancreatitis  4
Fetal bowel anomalies 1
Pending 2
Pending (NBS) 17




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 2821heterozygoteCF-causing - Trans
CF 3104heterozygoteCF-causing- Undef
CF 3113heterozygoteCF-causing - Trans
CF 3168heterozygoteCF-causing - Trans
CF 3231heterozygoteCF-causing- Undef
CF 3289heterozygoteCF-causing - Trans
CF 3103heterozygoteCF-causing- Undef
CF 3099heterozygoteCF-causing - Trans
CF 3097heterozygoteCF-causing- Undef
CF 2937heterozygoteCF-causing - Trans
CF 2938heterozygoteCF-causing - Trans
CF 2939heterozygoteCF-causing - Trans
CF 2942heterozygoteCF-causing- Undef
CF 2962heterozygoteCF-causing - Trans
CF 2983heterozygoteCF-causing - Trans
CF 2994heterozygoteCF-causing - Trans
CF 2995heterozygoteCF-causing - Trans
CF 3021heterozygoteCF-causing - Trans
CF 3034heterozygoteCF-causing - Trans
CF 3092heterozygoteCF-causing- Undef
CF 3409heterozygoteCF-causing - Trans
CF 4435heterozygoteCF-causing - Trans
CF 4463heterozygoteCF-causing - Trans
CF 4502heterozygoteCF-causing - Trans
CF 4518heterozygoteCF-causing - Trans
CF 6205heterozygoteCF-causing - Trans
CF 6005heterozygoteCF-causing - Trans
CF 4351heterozygoteCF-causing- Undef
CF 4169heterozygoteCF-causing- Undef
CF 5571heterozygoteCF-causing - Trans
CF 3466heterozygoteCF-causing- Undef
CF 3467heterozygoteCF-causing- Undef
CF 3556heterozygoteCF-causing- Undef
CF 3788heterozygoteCF-causing- Undef
CF 6020heterozygoteCF-causing - Trans
CF 2807heterozygoteCF-causing - Trans
CF 19heterozygoteCF-causing - Trans
CF 617heterozygoteCF-causing- Undef
CF 5246heterozygoteCF-causing - Trans
CF 742heterozygoteCF-causing- Undef
CF 802heterozygoteCF-causing- Undef
CF 1019heterozygoteCF-causing- Undef
CF 41heterozygoteCF-causing - Trans
CF 4688heterozygoteCF-causing - Trans
CF 126heterozygoteCF-causing - Trans
CF 156heterozygoteCF-causing- Undef
CF 262heterozygoteCF-causing - Trans
CF 282heterozygoteCF-causing- Undef
CF 321heterozygoteCF-causing- Undef
CF 1171heterozygoteCF-causing - Trans
CF 4858heterozygoteCF-causing- Undef
CF 2072heterozygoteCF-causing- Undef
CF 2231heterozygoteCF-causing- Undef
CF 2374heterozygoteCF-causing- Undef
CF 2552heterozygoteCF-causing- Undef
CF 2684heterozygoteCF-causing- Undef
CF 2691heterozygoteCF-causing - Trans
CF 2729heterozygoteCF-causing- Undef
CF 2733heterozygoteCF-causing - Trans
CF 2044heterozygoteCF-causing- Undef
CF 2013heterozygoteCF-causing- Undef
CF 1551heterozygoteCF-causing - Trans
CF 1764heterozygoteCF-causing- Undef
CF 1805heterozygoteCF-causing- Undef
CF 1807heterozygoteCF-causing- Undef
CF 1812heterozygoteCF-causing- Undef
CF 1819heterozygoteCF-causing- Undef
CF 1884heterozygoteCF-causing- Undef
CF 1970heterozygoteCF-causing- Undef
CF 901homozygotec.2657+5G>A - p.(=) - Trans
Other 4583heterozygoteCF-causing- Undef
Other 3589heterozygoteCF-causing - Trans
Other 3660heterozygoteCF-causing - Trans
Other 801heterozygoteCF-causing - Trans
Other 853heterozygoteCF-causing - Trans
Other 4730heterozygoteVUS3- Undef
Other 2021heterozygoteCF-causing- Undef
Bronchiectasis 2988heterozygoteCFTR-RD-causing - Trans
CF-causing - Trans
Bronchiectasis 4421heterozygoteCF-causing - Trans
Bronchiectasis 767heterozygotevarying clinical consequence - Trans
Bronchiectasis 4734heterozygoteCF-causing- Undef
Bronchiectasis 1902heterozygoteCF-causing- Undef
CBAVD 3311heterozygotevarying clinical consequence- Undef
CBAVD 3376heterozygoteCF-causing - Trans
CBAVD 4419heterozygoteCF-causing- Undef
CBAVD 4551heterozygoteCF-causing - Trans
CBAVD 3414heterozygotevarying clinical consequence- Undef
CBAVD 892heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 613heterozygoteCFTR-RD-causing- Undef
CBAVD 4838heterozygoteCFTR-RD-causing- Undef
CBAVD 519heterozygoteCF-causing - Trans
CBAVD 1369heterozygoteCF-causing- Undef
CBAVD 4874heterozygoteCFTR-RD-causing- Undef
CBAVD 4879heterozygotelikely CFTR-RD- Undef
CBAVD 2649heterozygoteCFTR-RD-causing- Undef
CBAVD 1672heterozygoteCF-causing- Undef
CBAVD 1878heterozygoteCF-causing- Undef
CBAVD 2800heterozygoteCFTR-RD-causing - Trans
varying clinical consequence - Trans
CRS-NP 95heterozygoteCF-causing- Undef
CRS-NP 4513heterozygoteCF-causing - Trans
Pending (NBS) 5013heterozygotenon-CF - Trans
Pending (NBS) 4631heterozygoteCF-causing- Undef
Pending (NBS) 4644heterozygoteCF-causing- Undef
Pending (NBS) 4751heterozygoteCF-causing - Trans
Pending (NBS) 2905heterozygoteCF-causing - Trans
Pending (NBS) 4354heterozygoteCF-causing - Trans
Pending (NBS) 4137heterozygoteCF-causing - Trans
Pending (NBS) 3453heterozygoteCF-causing- Undef
Pending (NBS) 3465heterozygoteCF-causing- Undef
Pending (NBS) 3817heterozygoteCF-causing - Trans
Pending (NBS) 3842heterozygoteCF-causing- Undef
Pending (NBS) 4014heterozygoteCF-causing- Undef
Pending (NBS) 748heterozygoteCF-causing - Trans
Pending (NBS) 934heterozygoteCF-causing - Trans
Pending (NBS) 5536heterozygoteCF-causing - Trans
Pending (NBS) 5071heterozygoteVUS3- Undef
VUS3- Undef
Pending (NBS) 2727heterozygoteCF-causing - Trans
Fetal bowel anomalies 584heterozygoteCF-causing - Trans
Pancreatitis 4614heterozygotevarying clinical consequence- Undef
Pancreatitis 1044heterozygote
Pancreatitis 2147heterozygoteVUS3- Undef
Pancreatitis 1832heterozygoteCF-causing- Undef
Pending 3165heterozygoteCFTR-RD-causing- Undef
Pending 5008heterozygoteCF-causing- Undef
Aquagenic palmoplantar keratoderma 4660heterozygoteCFTR-RD-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare