Variant NM_000492.4:c.366T>A


Variant details:
Name NM_000492.4:c.366T>A
Protein name NP_000483.3:p.(Tyr122*)
Genomic name (hg19)     chr7:g.117171045T>A    UCSC    
Genomic name (hg38) chr7:g.117530991T>A    UCSC
#Exon/intron exon 4
Legacy Name Y122X
Class disease-causing
Subclass CF-causing
WT sequence AGGAGGAACGCTCTATCGCGATTTA T CTAGGCATAGGCTTATGCCTTCTCT
Mutant sequence AGGAGGAACGCTCTATCGCGATTTA A CTAGGCATAGGCTTATGCCTTCTCT

Other databases:
dbSNP
rs79660178







Pathogenicity predictors:

Not found





No patient found in CFTR-NGS catalogue


53 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 53
Asymptomatic compound heterozygote 2
CF 36
CFTR-RD11
  • Bronchiectasis  1
  • CBAVD  6
  • Other  4
Fetal bowel anomalies 2
Pending 1
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 2599heterozygoteCF-causing- Undef
CF 2394heterozygoteCF-causing- Undef
CF 2339heterozygoteCF-causing- Undef
CF 2276heterozygoteCF-causing - Trans
CF 4936heterozygoteCF-causing- Undef
CF 2618heterozygoteCFTR-RD-causing- Undef
CF 4482heterozygoteCF-causing - Trans
VUS3- Undef
CF 4058heterozygoteCF-causing- Undef
CF 3848heterozygoteCF-causing- Undef
CF 3679heterozygoteCF-causing - Trans
CF 3185heterozygoteCF-causing- Undef
CF 2680heterozygoteCF-causing- Undef
CF 2679heterozygoteCF-causing- Undef
CF 6323heterozygoteVUS3 - Trans
VUS3 - Trans
CF 2657heterozygoteCFTR-RD-causing- Undef
CF 2619heterozygoteCFTR-RD-causing- Undef
CF 1949heterozygoteCF-causing- Undef
CF 1772heterozygoteCF-causing- Undef
CF 1713heterozygoteCF-causing- Undef
CF 970heterozygoteCF-causing - Trans
CF 117heterozygoteCF-causing - Trans
CF 105heterozygoteCF-causing - Trans
CF 1788heterozygoteCF-causing- Undef
CF 4697heterozygoteCF-causing - Trans
CF 6326heterozygoteVUS3- Undef
CF 1817heterozygotelikely CF- Undef
CF 1881heterozygoteCF-causing- Undef
CF 1877heterozygoteCF-causing- Undef
CF 1849heterozygoteCF-causing- Undef
CF 1618homozygotec.366T>A - p.(Tyr122*) - Trans
CF 1620homozygotec.366T>A - p.(Tyr122*) - Trans
CF 1630homozygotec.366T>A - p.(Tyr122*) - Trans
CF 1840homozygotec.366T>A - p.(Tyr122*) - Trans
CF 2468homozygotec.366T>A - p.(Tyr122*) - Trans
CF 1794homozygotec.366T>A - p.(Tyr122*) - Trans
CF 1795homozygotec.366T>A - p.(Tyr122*) - Trans
Other 4582heterozygoteCFTR-RD-causing- Undef
Other 2474heterozygoteCFTR-RD-causing- Undef
Other 609heterozygoteCFTR-RD-causing - Trans
Other 5677heterozygotevarying clinical consequence - Trans
CBAVD 2208heterozygoteCFTR-RD-causing- Undef
CBAVD 1634heterozygoteCFTR-RD-causing- Undef
CBAVD 5847heterozygoteVUS3- Undef
CBAVD 612heterozygotevarying clinical consequence- Undef
CBAVD 6400heterozygoteVUS3- Undef
CBAVD 4997heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 2183heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 2275heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 2210heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 2280heterozygoteCFTR-RD-causing- Undef
Fetal bowel anomalies 2569heterozygoteCF-causing- Undef
Fetal bowel anomalies 2388heterozygoteCF-causing- Undef
Pending 3049heterozygoteVUS3 - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare