Variant NM_000492.4:c.3705T>G
Name | NM_000492.4:c.3705T>G | ||||
Protein name | NP_000483.3:p.(Ser1235Arg) | ||||
Genomic name (hg19) | chr7:g.117267812T>G UCSC | ||||
Genomic name (hg38) | chr7:g.117627758T>G UCSC | ||||
#Exon/intron | exon 22 | ||||
Legacy Name | S1235R | ||||
Class | non disease-causing | ||||
complex allele in 12.70% of patients associated with WT sequence |
TAGAGAACATTTCCTTCTCAATAAG T CCTGGCCAGAGGGTGAGATTTGAAC |
Mutant sequence |
TAGAGAACATTTCCTTCTCAATAAG G CCTGGCCAGAGGGTGAGATTTGAAC |
|
![]() |
![]() | dbSNP rs34911792 |
![]() | ![]() |
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 63 |
---|---|
Asymptomatic compound heterozygote | 21 |
CF | 7 |
CFTR-RD | 35
|
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
Asymptomatic compound heterozygote | 3032 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 3020 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 2956 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 2928 | heterozygote | |
Asymptomatic compound heterozygote | 2863 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 2396 | heterozygote | CFTR-RD-causing - Trans VUS1 - Trans |
Asymptomatic compound heterozygote | 3333 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 4526 | heterozygote | VUS1 - Trans |
Asymptomatic compound heterozygote | 4517 | heterozygote | |
Asymptomatic compound heterozygote | 5164 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 1083 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 5812 | heterozygote | CF-causing- Undef |
Asymptomatic compound heterozygote | 5245 | heterozygote | VUS3 - Cis VUS2 - Trans |
Asymptomatic compound heterozygote | 4960 | heterozygote | CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 888 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 885 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 5081 | heterozygote | |
Asymptomatic compound heterozygote | 6251 | heterozygote | VUS3 - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 6250 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 6221 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 3083 | homozygote | |
CRS-NP | 349 | heterozygote | CF-causing - Trans VUS1- Undef |
CBAVD | 4531 | heterozygote | CF-causing- Undef |
CBAVD | 3288 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 2976 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
CBAVD | 4932 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 3332 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
CBAVD | 3369 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 3334 | heterozygote | varying clinical consequence - Cis CFTR-RD-causing - Trans |
CBAVD | 474 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 470 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 1908 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 1256 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CBAVD | 6468 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans |
CF | 3119 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 4267 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 6255 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
CF | 1137 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 5244 | heterozygote | VUS3 - Cis CF-causing - Trans |
CF | 716 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 1815 | heterozygote | CF-causing- Undef |
Other | 4293 | heterozygote | |
Other | 5136 | heterozygote | CF-causing- Undef |
Other | 1217 | heterozygote | CF-causing - Trans |
Pancreatitis | 3221 | heterozygote | |
Pancreatitis | 2871 | heterozygote | |
Pancreatitis | 4343 | heterozygote | |
Pancreatitis | 4273 | heterozygote | |
Pancreatitis | 4252 | heterozygote | |
Pancreatitis | 5949 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pancreatitis | 3399 | heterozygote | |
Pancreatitis | 1225 | heterozygote | CF-causing - Trans |
Pancreatitis | 5864 | heterozygote | varying clinical consequence - Trans |
Pancreatitis | 5739 | heterozygote | CF-causing - Trans |
Bronchiectasis | 2526 | heterozygote | CF-causing - Trans |
Bronchiectasis | 4816 | heterozygote | |
Bronchiectasis | 2373 | heterozygote | VUS3- Undef |
Bronchiectasis | 2086 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 5873 | heterozygote | CF-causing- Undef |
Bronchiectasis | 1866 | heterozygote | CF-causing- Undef |
Bronchiectasis | 5103 | heterozygote | CF-causing- Undef |
Bronchiectasis | 1761 | heterozygote | CF-causing - Trans |
Bronchiectasis | 1756 | heterozygote | CF-causing - Trans |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|