Variant NM_000492.4:c.3705T>G


Variant details:
Name NM_000492.4:c.3705T>G
Protein name NP_000483.3:p.(Ser1235Arg)
Genomic name (hg19) chr7:g.117267812T>G    UCSC    
#Exon/intron exon 22
Legacy Name S1235R
Class non disease-causing
complex allele in 13.79% of patients associated with
  • c.1210-34_1210-6TG[13]T[5] : 100.00%
    • WT sequence TAGAGAACATTTCCTTCTCAATAAG T CCTGGCCAGAGGGTGAGATTTGAAC
    Mutant sequence TAGAGAACATTTCCTTCTCAATAAG G CCTGGCCAGAGGGTGAGATTTGAAC

    Other databases:
    dbSNP
    rs34911792



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Van Goor et al, 2014 23891399 ✓ ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓
    LaRusch et al, 2014 25033378 ✓ ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results




    No patient found in CFTR-NGS catalogue


    58 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 58
    Asymptomatic compound heterozygote 18
    CF 5
    CFTR-RD34
    • Bronchiectasis  9
    • CBAVD  11
    • CRS-NP  1
    • Other  3
    • Pancreatitis  10
    Pending (NBS) 1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    Asymptomatic compound heterozygote 3032heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3020heterozygotevarying clinical consequence - Cis
    CF-causing - Trans
    Asymptomatic compound heterozygote 2956heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 2928heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 2863heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3333heterozygotevarying clinical consequence - Cis
    varying clinical consequence - Trans
    Asymptomatic compound heterozygote 4526heterozygoteVUS1 - Trans
    Asymptomatic compound heterozygote 4517heterozygoteCFTR-RD-causing - Trans
    CFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 5164heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 2396heterozygoteCFTR-RD-causing - Trans
    VUS1 - Trans
    Asymptomatic compound heterozygote 1083heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 5812heterozygoteCF-causing- Undef
    Asymptomatic compound heterozygote 5245heterozygoteVUS3 - Cis
    VUS2 - Trans
    Asymptomatic compound heterozygote 4960heterozygoteCFTR-RD-causing- Undef
    Asymptomatic compound heterozygote 888heterozygoteVUS3 - Trans
    Asymptomatic compound heterozygote 885heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 5081heterozygoteCFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 3083homozygote
    CRS-NP 349heterozygoteCF-causing - Trans
    VUS1- Undef
    CBAVD 4531heterozygoteCF-causing- Undef
    CBAVD 3332heterozygotevarying clinical consequence - Cis
    varying clinical consequence - Trans
    CBAVD 3288heterozygoteVUS3 - Cis
    CF-causing - Trans
    CBAVD 2976heterozygotevarying clinical consequence- Undef
    CF-causing- Undef
    CBAVD 4932heterozygoteCF-causing- Undef
    varying clinical consequence- Undef
    CBAVD 3334heterozygotevarying clinical consequence - Cis
    CFTR-RD-causing - Trans
    CBAVD 3369heterozygotevarying clinical consequence - Cis
    CF-causing - Trans
    CBAVD 474heterozygotevarying clinical consequence - Cis
    CF-causing - Trans
    CBAVD 470heterozygotevarying clinical consequence - Cis
    CF-causing - Trans
    CBAVD 1908heterozygotevarying clinical consequence - Cis
    CF-causing - Trans
    CBAVD 1256heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CF 3119heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 4267heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 716heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 1137heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 1815heterozygoteCF-causing- Undef
    Other 4293heterozygote
    Other 5136heterozygoteCF-causing- Undef
    Other 1217heterozygoteCF-causing - Trans
    Pending (NBS) 5244heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pancreatitis 3221heterozygote
    Pancreatitis 2871heterozygote
    Pancreatitis 4343heterozygote
    Pancreatitis 4273heterozygote
    Pancreatitis 4252heterozygote
    Pancreatitis 5949heterozygotevarying clinical consequence - Cis
    CF-causing - Trans
    Pancreatitis 3399heterozygote
    Pancreatitis 1225heterozygoteCF-causing - Trans
    Pancreatitis 5864heterozygotevarying clinical consequence - Trans
    Pancreatitis 5739heterozygoteCF-causing - Trans
    Bronchiectasis 4816heterozygote
    Bronchiectasis 2526heterozygoteCF-causing - Trans
    Bronchiectasis 2373heterozygoteVUS3- Undef
    Bronchiectasis 2086heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 5873heterozygoteCF-causing- Undef
    Bronchiectasis 1866heterozygoteCF-causing- Undef
    Bronchiectasis 5103heterozygoteCF-causing- Undef
    Bronchiectasis 1761heterozygoteCF-causing - Trans
    Bronchiectasis 1756heterozygoteCF-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare