Variant NM_000492.4:c.617T>G


Variant details:
Name NM_000492.4:c.617T>G
Protein name NP_000483.3:p.(Leu206Trp)
Genomic name (hg19) chr7:g.117175339T>G    UCSC    
#Exon/intron exon 6
Legacy Name L206W
Class disease-causing
Subclass varying clinical consequence
complex allele in 5.30% of patients associated with
  • c.1210-34_1210-6TG[9]T[9] : 100.00%
    • WT sequence GCACATTTCGTGTGGATCGCTCCTT T GCAAGTGGCACTCCTCATGGGGCTA
    Mutant sequence GCACATTTCGTGTGGATCGCTCCTT G GCAAGTGGCACTCCTCATGGGGCTA

    Other databases:
    dbSNP
    rs121908752



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Clain et al, 2005 15776432 ✓ ✓ ✓
    Van Goor et al, 2014 23891399 ✓ ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnono yes
    TEZ-IVA yes yesno yes
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    No patient found in CFTR-NGS catalogue


    132 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 132
    Asymptomatic compound heterozygote 3
    CF 28
    CFTR-RD68
    • Bronchiectasis  7
    • CBAVD  46
    • CRS-NP  1
    • Other  6
    • Pancreatitis  8
    Pending 1
    Pending (NBS) 29
    Pending non-CF 3




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CF 2655heterozygoteCF-causing- Undef
    CF 2827heterozygoteCF-causing - Trans
    CF 3223heterozygoteCF-causing- Undef
    CF 4899heterozygoteCF-causing - Trans
    CF 2253heterozygoteCF-causing- Undef
    CF 5863heterozygoteCF-causing- Undef
    CF 2016heterozygoteCF-causing- Undef
    CF 2109heterozygoteCF-causing- Undef
    CF 2197heterozygoteCF-causing- Undef
    CF 6096heterozygoteCF-causing- Undef
    CF 6202heterozygoteCF-causing - Trans
    CF 4485heterozygoteCF-causing - Trans
    CF 5622heterozygoteCF-causing - Trans
    CF 3917heterozygoteCF-causing - Trans
    CF 4390heterozygoteCF-causing - Trans
    CF 4464heterozygoteCF-causing - Trans
    CF 4479heterozygoteCF-causing - Trans
    CF 38heterozygoteVUS3 - Trans
    CF 821heterozygoteCF-causing - Trans
    CF 822heterozygoteCF-causing - Trans
    CF 90heterozygoteCF-causing - Trans
    CF 263heterozygoteCF-causing - Trans
    CF 277heterozygoteCF-causing- Undef
    CF 280heterozygoteCF-causing - Trans
    CF 381heterozygoteCF-causing - Trans
    CF 1693heterozygoteCF-causing- Undef
    CF 5132heterozygoteCF-causing - Trans
    CF 4782heterozygoteCF-causing - Trans
    Other 4528heterozygoteCF-causing - Trans
    Other 4676heterozygoteCF-causing - Trans
    Other 5813heterozygoteCFTR-RD-causing- Undef
    Other 4783heterozygoteCF-causing - Trans
    Other 4800heterozygoteVUS3- Undef
    CF-causing- Undef
    VUS3- Undef
    Other 5184heterozygoteCF-causing - Trans
    VUS3- Undef
    VUS3- Undef
    CBAVD 5375heterozygoteCF-causing - Trans
    CBAVD 4935heterozygoteCF-causing- Undef
    CBAVD 4937heterozygoteCF-causing- Undef
    CBAVD 2631heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 2817heterozygoteCF-causing- Undef
    CBAVD 3353heterozygoteCFTR-RD-causing- Undef
    CBAVD 3374heterozygoteCFTR-RD-causing- Undef
    CBAVD 4877heterozygoteCF-causing - Trans
    CBAVD 5459heterozygotevarying clinical consequence - Trans
    CBAVD 1930heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 2203heterozygoteCF-causing- Undef
    CBAVD 3381heterozygoteCFTR-RD-causing- Undef
    CBAVD 3414heterozygotevarying clinical consequence- Undef
    CBAVD 4592heterozygoteCFTR-RD-causing - Trans
    CBAVD 4597heterozygoteCFTR-RD-causing- Undef
    CBAVD 6173heterozygoteCF-causing- Undef
    CBAVD 5594heterozygoteCF-causing- Undef
    CBAVD 548heterozygoteCF-causing - Trans
    CBAVD 614heterozygoteCF-causing- Undef
    CBAVD 643heterozygoteCFTR-RD-causing- Undef
    CBAVD 765heterozygoteCF-causing- Undef
    CBAVD 834heterozygoteCF-causing - Trans
    CBAVD 840heterozygoteCF-causing - Trans
    CBAVD 857heterozygoteCF-causing- Undef
    CBAVD 881heterozygoteVUS3- Undef
    CBAVD 491heterozygoteCF-causing- Undef
    CBAVD 490heterozygoteCF-causing- Undef
    CBAVD 434heterozygoteCF-causing - Trans
    CBAVD 4679heterozygoteCF-causing - Trans
    CBAVD 4837heterozygoteCFTR-RD-causing- Undef
    CBAVD 422heterozygoteCF-causing - Trans
    CBAVD 912heterozygoteCF-causing - Trans
    CBAVD 1163heterozygoteCF-causing- Undef
    CBAVD 1329heterozygoteCF-causing- Undef
    CBAVD 1363heterozygoteCF-causing- Undef
    CBAVD 1412heterozygoteCFTR-RD-causing- Undef
    CFTR-RD-causing- Undef
    CFTR-RD-causing- Undef
    CBAVD 1413heterozygoteCFTR-RD-causing- Undef
    CBAVD 1438heterozygoteCFTR-RD-causing- Undef
    CBAVD 1442heterozygoteCF-causing- Undef
    CBAVD 1463heterozygoteCF-causing- Undef
    CBAVD 1679heterozygotevarying clinical consequence- Undef
    CBAVD 1748heterozygoteCF-causing- Undef
    CBAVD 978heterozygoteCF-causing - Trans
    CBAVD 5221heterozygoteCF-causing- Undef
    CBAVD 1052heterozygotevarying clinical consequence- Undef
    CBAVD 1056heterozygoteCF-causing- Undef
    Pending 4680heterozygoteCF-causing - Trans
    Pending non-CF 4681heterozygoteCF-causing - Trans
    Pending non-CF 4677heterozygoteCF-causing - Trans
    Pending non-CF 4515heterozygotevarying clinical consequence - Trans
    Bronchiectasis 2055heterozygoteCF-causing- Undef
    Bronchiectasis 4602heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 4488heterozygote
    Bronchiectasis 850heterozygoteCF-causing - Trans
    Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 962heterozygoteVUS2 - Cis
    CF-causing - Trans
    Bronchiectasis 1096heterozygoteCF-causing- Undef
    Pending (NBS) 2964heterozygoteCF-causing - Trans
    Pending (NBS) 3118heterozygoteCF-causing- Undef
    Pending (NBS) 4654heterozygoteCF-causing - Trans
    Pending (NBS) 5443heterozygoteCF-causing - Trans
    Pending (NBS) 6095heterozygoteCF-causing- Undef
    Pending (NBS) 6185heterozygoteCF-causing - Trans
    Pending (NBS) 6001heterozygoteCF-causing- Undef
    Pending (NBS) 6100heterozygoteCF-causing- Undef
    Pending (NBS) 6008heterozygoteCF-causing- Undef
    Pending (NBS) 5342heterozygoteCF-causing - Trans
    Pending (NBS) 3655heterozygoteCF-causing - Trans
    Pending (NBS) 3676heterozygoteCF-causing - Trans
    Pending (NBS) 3884heterozygoteCF-causing - Trans
    Pending (NBS) 4228heterozygoteCF-causing - Trans
    Pending (NBS) 4266heterozygoteCF-causing- Undef
    Pending (NBS) 4407heterozygoteCF-causing - Trans
    Pending (NBS) 6011heterozygoteCF-causing- Undef
    Pending (NBS) 590heterozygoteCF-causing - Trans
    Pending (NBS) 794heterozygoteCF-causing - Trans
    Pending (NBS) 799heterozygoteCF-causing - Trans
    Pending (NBS) 4821heterozygoteCF-causing - Trans
    Pending (NBS) 1180heterozygoteCF-causing - Trans
    Pending (NBS) 1547heterozygoteCF-causing - Trans
    Pending (NBS) 1076heterozygoteCF-causing - Trans
    Pending (NBS) 5190heterozygoteCF-causing- Undef
    VUS3- Undef
    VUS3- Undef
    Pending (NBS) 1064heterozygoteCF-causing - Trans
    Pending (NBS) 5852heterozygoteCF-causing - Trans
    Pending (NBS) 4769heterozygoteCF-causing- Undef
    Pending (NBS) 5046heterozygoteCF-causing- Undef
    Asymptomatic compound heterozygote 5376heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 6195heterozygoteCF-causing- Undef
    Asymptomatic compound heterozygote 5744heterozygoteVUS2- Undef
    Pancreatitis 2623heterozygoteCF-causing- Undef
    Pancreatitis 3259heterozygoteCF-causing- Undef
    Pancreatitis 5452heterozygoteCF-causing- Undef
    Pancreatitis 5864heterozygote
    Pancreatitis 1960heterozygoteCF-causing- Undef
    Pancreatitis 2067heterozygoteCF-causing- Undef
    Pancreatitis 4270heterozygoteCF-causing - Trans
    Pancreatitis 1063heterozygoteCF-causing - Trans
    CRS-NP 6196heterozygoteCF-causing- Undef


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare