Variant NM_000492.4:c.1000C>T


Variant details:
Name NM_000492.4:c.1000C>T
Protein name NP_000483.3:p.(Arg334Trp)
Genomic name (hg19) chr7:g.117180284C>T    UCSC    
#Exon/intron exon 8
Legacy Name R334W
Class disease-causing
Subclass CF-causing
WT sequence TGCACTAATCAAAGGAATCATCCTC C GGAAAATATTCACCACCATCTCATT
Mutant sequence TGCACTAATCAAAGGAATCATCCTC T GGAAAATATTCACCACCATCTCATT

Other databases:
dbSNP
rs121909011



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sheppard et al, 1993 7680769
Van Goor et al, 2014 23891399
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results




No patient found in CFTR-NGS catalogue


35 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 35
Asymptomatic compound heterozygote 1
CF 27
CFTR-RD5
  • Bronchiectasis  2
  • CBAVD  2
  • Other  1
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 12heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1837heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2007heterozygoteCF-causing - Cis
CF-causing- Undef
CF 2154heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2216heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2332heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2506heterozygoteCF-causing - Cis
CF-causing- Undef
CF 2507heterozygoteCF-causing - Cis
CF-causing- Undef
CF 2519heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3070heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3621heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4104heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1653heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1590heterozygoteCF-causing - Cis
CF-causing- Undef
CF 23heterozygoteCF-causing - Cis
CF-causing - Trans
CF 92heterozygoteCF-causing - Cis
CF-causing - Trans
CF 100heterozygoteCF-causing - Cis
CF-causing - Trans
CF 237heterozygoteCF-causing - Cis
CF-causing - Trans
CF 636heterozygoteCF-causing - Cis
CF-causing - Trans
CF 684heterozygoteCF-causing- Undef
CF-causing- Undef
CF 804heterozygoteCF-causing - Cis
CF-causing - Trans
CF 957heterozygoteCF-causing - Cis
CF-causing - Trans
CF 984heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1230heterozygoteCF-causing - Cis
CF 4869heterozygoteCF-causing - Cis
CF-causing- Undef
CF 4609heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1116homozygotec.1000C>T - p.(Arg334Trp) - Trans
Bronchiectasis 6220heterozygoteCF-causing - Cis
varying clinical consequence- Undef
Bronchiectasis 4834heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Other 627heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Asymptomatic compound heterozygote 4959heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 4932heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CBAVD 1468heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 3135heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 4645heterozygoteCF-causing- Undef
VUS3- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare