Variant NM_000492.4:c.1040G>A


Variant details:
Name NM_000492.4:c.1040G>A
Protein name NP_000483.3:p.(Arg347His)
Genomic name (hg19)     chr7:g.117180324G>A    UCSC    
Genomic name (hg38) chr7:g.117540270G>A    UCSC
#Exon/intron exon 8
Legacy Name R347H
Class disease-causing
Subclass varying clinical consequence
WT sequence ACCATCTCATTCTGCATTGTTCTGC G CATGGCGGTCACTCGGCAATTTCCC
Mutant sequence ACCATCTCATTCTGCATTGTTCTGC A CATGGCGGTCACTCGGCAATTTCCC

Other databases:
dbSNP
rs77932196



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Clain et al, 2001 11118444 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yesnono yes
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


No patient found in CFTR-NGS catalogue


54 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 54
Asymptomatic compound heterozygote 3
CF 21
CFTR-RD18
  • Bronchiectasis  4
  • CBAVD  10
  • Other  3
  • Pancreatitis  1
Pending 2
Pending (NBS) 10




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3107heterozygoteCF-causing- Undef
CF 2809heterozygoteCF-causing- Undef
CF 2701heterozygoteCF-causing- Undef
CF 3287heterozygoteCF-causing - Trans
CF 4166heterozygoteCF-causing- Undef
CF 3994heterozygoteCF-causing- Undef
CF 3822heterozygoteCF-causing- Undef
CF 3766heterozygoteCF-causing- Undef
CF 943heterozygoteCF-causing - Trans
CF 582heterozygoteCF-causing- Undef
CF 326heterozygoteCF-causing- Undef
CF 4778heterozygoteCF-causing - Trans
CF 4785heterozygoteCF-causing- Undef
CF 2281heterozygoteCF-causing- Undef
CF 2245heterozygoteCF-causing- Undef
CF 6281heterozygoteCF-causing- Undef
CF 1658heterozygoteCF-causing- Undef
CF 1610heterozygoteCF-causing- Undef
CF 1238heterozygoteCF-causing - Trans
CF 1233heterozygoteCF-causing- Undef
CF 25heterozygoteCF-causing - Trans
CBAVD 3003heterozygoteCF-causing - Trans
CBAVD 3002heterozygoteCF-causing - Trans
CBAVD 2353heterozygoteCF-causing- Undef
CBAVD 647heterozygoteCF-causing- Undef
CBAVD 417heterozygoteCF-causing - Trans
CBAVD 404heterozygoteVUS3- Undef
CBAVD 398heterozygoteCF-causing - Trans
CBAVD 394heterozygoteCF-causing - Trans
CBAVD 6396heterozygoteVUS3- Undef
CBAVD 1982homozygotec.1040G>A - p.(Arg347His) - Trans
Bronchiectasis 3240heterozygoteCF-causing - Trans
Bronchiectasis 5137heterozygoteCF-causing- Undef
Bronchiectasis 767heterozygotevarying clinical consequence - Trans
Bronchiectasis 2118heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 2980heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 3277heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 5747heterozygoteVUS3- Undef
Pending (NBS) 6033heterozygoteCF-causing- Undef
Pending (NBS) 2970heterozygoteCF-causing - Trans
Pending (NBS) 2895heterozygoteCF-causing - Trans
Pending (NBS) 4620heterozygoteCF-causing- Undef
Pending (NBS) 6081heterozygoteCF-causing- Undef
Pending (NBS) 3724heterozygoteCF-causing- Undef
Pending (NBS) 3707heterozygoteCF-causing- Undef
Pending (NBS) 3548heterozygoteCF-causing- Undef
Pending (NBS) 6338heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 6215heterozygoteCF-causing - Trans
Pending 3574heterozygoteCF-causing - Trans
Pending 2447heterozygoteCF-causing- Undef
Other 2540heterozygoteCF-causing - Trans
Other 6112heterozygoteCF-causing- Undef
Other 3404heterozygoteCF-causing - Trans
Pancreatitis 2617heterozygoteCF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare