Variant NM_000492.4:c.1364C>A


Variant details:
Name NM_000492.4:c.1364C>A
Protein name NP_000483.3:p.(Ala455Glu)
Genomic name (hg19)     chr7:g.117188849C>A    UCSC    
Genomic name (hg38) chr7:g.117548795C>A    UCSC
#Exon/intron exon 10
Legacy Name A455E
Class disease-causing
Subclass CF-causing
WT sequence AAGATAGAAAGAGGACAGTTGTTGG C GGTTGCTGGATCCACTGGAGCAGGC
Mutant sequence AAGATAGAAAGAGGACAGTTGTTGG A GGTTGCTGGATCCACTGGAGCAGGC

Other databases:
dbSNP
rs74551128



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sheppard et al, 1995 7534226 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnono yes

clinical and functional data presented above are provided by Vertex


No patient found in CFTR-NGS catalogue


33 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 33
CF 28
CFTR-RD4
  • CBAVD  3
  • CRS-NP  1
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 318heterozygoteCF-causing- Undef
CF 3142heterozygoteCF-causing - Trans
VUS3- Undef
CF 3154heterozygoteCF-causing - Trans
CF 3169heterozygoteCF-causing - Trans
CF 3189heterozygoteCF-causing - Trans
CF 3192heterozygoteCF-causing- Undef
CF 3229heterozygoteCF-causing- Undef
CF 3306heterozygoteCF-causing - Trans
CF 3384heterozygoteCF-causing - Trans
CF 6441heterozygoteCF-causing- Undef
CF 6456heterozygotevarying clinical consequence - Trans
VUS3- Undef
CF 3450heterozygoteCF-causing - Trans
CF 3071heterozygoteCF-causing - Trans
CF 3010heterozygoteCF-causing - Trans
CF 2996heterozygoteCF-causing - Trans
CF 5517heterozygoteCF-causing - Trans
CF 1093heterozygoteCF-causing - Trans
CF 1100heterozygoteCF-causing - Trans
CF 1187heterozygoteCF-causing - Trans
CF 1710heterozygoteCF-causing- Undef
CF 5384heterozygoteCF-causing - Trans
CF 2105heterozygoteCF-causing- Undef
CF 2349heterozygoteCF-causing- Undef
CF 2669heterozygoteCF-causing- Undef
CF 2782heterozygoteCF-causing- Undef
CF 2896heterozygoteCF-causing - Trans
CF 2911heterozygoteCF-causing - Trans
CF 3762heterozygoteCF-causing- Undef
CRS-NP 1220heterozygoteCF-causing- Undef
CBAVD 3313heterozygoteCFTR-RD-causing- Undef
CBAVD 5344heterozygoteCF-causing- Undef
CBAVD 2948heterozygoteCF-causing- Undef
Pending (NBS) 4751heterozygotevarying clinical consequence - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare