Variant NM_000492.4:c.1393-61A>G
| Name | NM_000492.4:c.1393-61A>G |
| Protein name | NP_000483.3:p.(=) |
| Genomic name (hg19) | chr7:g.117199457A>G UCSC |
| Genomic name (hg38) | chr7:g.117559403A>G UCSC |
| #Exon/intron | intron 10 |
| Legacy Name | 1525-61A/G |
| Class | non disease-causing |
| WT sequence | CACTTCTGCTTAGGATGATAATTGG A GGCAAGTGAATCCTGAGCGTGATTT |
| Mutant sequence | CACTTCTGCTTAGGATGATAATTGG G GGCAAGTGAATCCTGAGCGTGATTT |
![]() | ![]() Not found | dbSNP rs34855237 |
![]() Not found | ![]() |
73 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 250 |
|---|---|
| Asymptomatic compound heterozygote | 12 |
| CF | 81 |
| CFTR-RD | 126
|
| Fetal bowel anomalies | 5 |
| Pending | 2 |
| Pending (NBS) | 20 |
| Pending non-CF | 4 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CF | 924 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 920 | heterozygote | VUS2- Undef CF-causing- Undef CF-causing- Undef |
| CF | 909 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 907 | heterozygote | CF-causing- Undef likely CF- Undef |
| CF | 926 | heterozygote | CF-causing - Cis varying clinical consequence - Trans |
| CF | 956 | heterozygote | CF-causing - Cis CF-causing - Trans |
| CF | 953 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 952 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 947 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 945 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 835 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 829 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 808 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 787 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 884 | heterozygote | CF-causing - Cis CF-causing - Trans |
| CF | 882 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 975 | heterozygote | CF-causing- Undef |
| CF | 5185 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 4796 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CF | 4791 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 5186 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 5066 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5064 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2880 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 5189 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 5143 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4832 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4831 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef varying clinical consequence- Undef |
| CF | 989 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 984 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5256 | heterozygote | CF-causing- Undef VUS2- Undef CF-causing- Undef |
| CF | 5089 | heterozygote | CF-causing - Cis varying clinical consequence - Trans |
| CF | 652 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4845 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4732 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 96 | heterozygote | VUS2 - Cis CF-causing - Cis CF-causing - Trans |
| CF | 152 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 651 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 586 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 561 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 316 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 313 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CF | 206 | heterozygote | CF-causing- Undef |
| CF | 4719 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4716 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4665 | heterozygote | VUS3- Undef |
| CF | 733 | heterozygote | CF-causing- Undef VUS3- Undef |
| CF | 913 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 711 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 703 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 696 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef CF-causing- Undef |
| CF | 738 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 762 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 761 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 745 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 744 | heterozygote | VUS3- Undef |
| CF | 691 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 688 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 681 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 672 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 668 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 654 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 662 | heterozygote | VUS2- Undef CF-causing- Undef varying clinical consequence- Undef |
| CF | 686 | heterozygote | VUS3- Undef |
| CF | 663 | heterozygote | VUS2- Undef CF-causing- Undef varying clinical consequence- Undef |
| CF | 666 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 946 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| CF | 943 | homozygote | c.1040G>A - p.(Arg347His) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CF | 1140 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3964-78_4242+577del - p.(Gly1323_Val1415del) - Trans |
| CF | 637 | homozygote | c.3484C>T - p.(Arg1162*) - Trans c.695T>A - p.(Val232Asp) - Trans |
| CF | 3963 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| CF | 3969 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2988+1173_3468+2111del - p.(Leu997_Leu1156del) - Trans |
| CF | 5534 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3605del - p.(Asp1202Alafs*9) - Trans |
| CF | 973 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1624G>T - p.(Gly542*) - Trans |
| CF | 716 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3822G>A - p.(Trp1274*) - Trans |
| CF | 5244 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.941G>T - p.(Gly314Val) - Trans |
| CF | 982 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| CF | 863 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1705T>G - p.(Tyr569Asp) - Trans |
| CF | 930 | homozygote | c.3909C>G - p.(Asn1303Lys) - Trans |
| CF | 343 | homozygote | c.1585-9412A>G - p.(=) - Trans c.3909C>G - p.(Asn1303Lys) - Trans |
| CF | 905 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Fetal bowel anomalies | 4670 | heterozygote | CF-causing - Cis CF-causing - Trans |
| Fetal bowel anomalies | 4709 | heterozygote | CF-causing - Cis CF-causing - Trans |
| Fetal bowel anomalies | 917 | heterozygote | CF-causing- Undef CF-causing- Undef |
| Fetal bowel anomalies | 923 | heterozygote | CF-causing - Cis CF-causing - Trans |
| Fetal bowel anomalies | 948 | heterozygote | CF-causing - Cis CF-causing - Trans |
| Other | 937 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 845 | heterozygote | CF-causing- Undef |
| Other | 864 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 877 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 779 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 3247 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 5184 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| Other | 4800 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| Other | 4799 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Other | 5128 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 6343 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 5823 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef VUS3- Undef |
| Other | 5201 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 5243 | heterozygote | VUS3- Undef |
| Other | 980 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef varying clinical consequence- Undef |
| Other | 5264 | heterozygote | VUS3- Undef CF-causing- Undef |
| Other | 5518 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4844 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 4836 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 4846 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 4702 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 4695 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4690 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4686 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4671 | heterozygote | VUS3- Undef |
| Other | 4705 | heterozygote | CF-causing- Undef CF-causing- Undef |
| Other | 4715 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4714 | heterozygote | CF-causing- Undef |
| Other | 4713 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| Other | 757 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 756 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4698 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2909-15T>G - p.(=) - Trans |
| Other | 940 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
| Asymptomatic compound heterozygote | 925 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 932 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| Asymptomatic compound heterozygote | 4829 | heterozygote | CF-causing- Undef VUS2- Undef |
| Asymptomatic compound heterozygote | 5818 | heterozygote | CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4961 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 4839 | heterozygote | CF-causing- Undef VUS2- Undef |
| Asymptomatic compound heterozygote | 4840 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 372 | heterozygote | VUS3 - Cis CF-causing - Trans |
| Asymptomatic compound heterozygote | 5077 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 5081 | heterozygote | |
| Asymptomatic compound heterozygote | 4685 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 5140 | homozygote | c.1118A>G - p.(Asp373Gly) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Bronchiectasis | 921 | heterozygote | CF-causing- Undef VUS3- Undef |
| Bronchiectasis | 950 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 899 | heterozygote | CF-causing- Undef |
| Bronchiectasis | 850 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5182 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Bronchiectasis | 5200 | heterozygote | CF-causing- Undef non-CF- Undef VUS3- Undef |
| Bronchiectasis | 4833 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 4734 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 4725 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Bronchiectasis | 4678 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5826 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3718-2477C>T - p.(=) - Trans |
| CBAVD | 918 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 912 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 904 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 927 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 949 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 900 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 897 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 849 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 840 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 834 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 806 | heterozygote | VUS3- Undef |
| CBAVD | 859 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 895 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 894 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 893 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 891 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 890 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 876 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 875 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 873 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 868 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 5181 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 1469 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 5234 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 5821 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4830 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 988 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5809 | heterozygote | likely CFTR-RD- Undef VUS3- Undef |
| CBAVD | 978 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4956 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 4740 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 413 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4722 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 626 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 515 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4699 | heterozygote | CFTR-RD-causing- Undef VUS2- Undef CF-causing- Undef |
| CBAVD | 4683 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4682 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
| CBAVD | 4679 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4703 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4717 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4707 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 4706 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 735 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 724 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 721 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 717 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 712 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 710 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 736 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 743 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 774 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 765 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 763 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 751 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 746 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 679 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 656 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 678 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 675 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 665 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 658 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 728 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 687 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 682 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef varying clinical consequence- Undef |
| CBAVD | 647 | homozygote | c.1040G>A - p.(Arg347His) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 786 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 837 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 838 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3415A>G - p.(Ile1139Val) - Trans |
| Pending (NBS) | 951 | heterozygote | VUS2- Undef CF-causing- Undef likely CF- Undef |
| Pending (NBS) | 944 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| Pending (NBS) | 799 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 794 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5183 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS3- Undef |
| Pending (NBS) | 4787 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Pending (NBS) | 5202 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS3- Undef |
| Pending (NBS) | 5190 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5808 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 5816 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pending (NBS) | 5817 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending (NBS) | 5820 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
| Pending (NBS) | 5533 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 5247 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef VUS1- Undef |
| Pending (NBS) | 4720 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending (NBS) | 4694 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 775 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 734 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending (NBS) | 646 | homozygote | c.1210-34_1210-6TG[13]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Pending (NBS) | 726 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.1801A>T - p.(Ile601Phe) - Trans |
| Pending | 4680 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending | 5216 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending non-CF | 4681 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending non-CF | 4704 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending non-CF | 4677 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending non-CF | 753 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pancreatitis | 964 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 3245 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| Pancreatitis | 5142 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 5145 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 776 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pancreatitis | 4721 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pancreatitis | 669 | heterozygote | CF-causing- Undef |
| CRS-NP | 349 | heterozygote | varying clinical consequence- Undef VUS3- Undef varying clinical consequence- Undef |
| CRS-NP | 910 | heterozygote | CF-causing- Undef |
| CRS-NP | 5531 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| Aquagenic palmoplantar keratoderma | 4827 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Aquagenic palmoplantar keratoderma | 6335 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|