Variant NM_000492.4:c.1408A>G


Variant details:
Name NM_000492.4:c.1408A>G
Protein name NP_000483.3:p.(Met470Val)
Genomic name (hg19) chr7:g.117199533G>A    UCSC    
#Exon/intron exon 11
Legacy Name M470V
Class non disease-causing
WT sequence TTATTTCCAGACTTCACTTCTAATG G TGATTATGGGAGAACTGGAGCCTTC
Mutant sequence TTATTTCCAGACTTCACTTCTAATG A TGATTATGGGAGAACTGGAGCCTTC

Other databases:
dbSNP
rs213950




Pathogenicity predictors:

Not found


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results




No patient found in CFTR-NGS catalogue


989 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 989
Asymptomatic compound heterozygote 36
CF 352
CFTR-RD535
  • Aquagenic palmoplantar keratoderma  2
  • Bronchiectasis  61
  • CBAVD  291
  • CRS-NP  11
  • Other  79
  • Pancreatitis  91
Fetal bowel anomalies 11
Pending 16
Pending (NBS) 36
Pending non-CF 3




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 2283heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1585heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1577heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1571heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 1570heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1569heterozygote
CF 1567heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1533heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1527heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CF 1526heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1520heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1519heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 1515heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1540heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1541heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1562heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 1561heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1558heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1556heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1551heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1550heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1549heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 1546heterozygoteCF-causing- Undef
CF 1545heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1543heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4872heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2763heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2499heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2495heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2494heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2479heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2472heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2644heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2524heterozygoteVUS3- Undef
CF-causing- Undef
CF 2385heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2380heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2363heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2350heterozygoteCF-causing- Undef
CF 2442heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2429heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1128heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4791heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 1042heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 1121heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1101heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
CF 4780heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4776heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
CF 4962heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 5143heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4832heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4831heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 1018heterozygoteCF-causing- Undef
VUS3- Undef
CF 5256heterozygoteVUS3- Undef
VUS2- Undef
CF-causing- Undef
CF 1310heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1309heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1306heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1304heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1300heterozygoteCF-causing- Undef
CF 1299heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1298heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1297heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1311heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1315heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4859heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4854heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4855heterozygoteVUS3- Undef
CF-causing- Undef
CF 4864heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4862heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4869heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4853heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1279heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1235heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1170heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1166heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1157heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1153heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1151heterozygoteCF-causing- Undef
VUS3- Undef
CF 1138heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1273heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 1266heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1262heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1259heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1258heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1254heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4237heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4287heterozygoteCF-causing- Undef
CF 4307heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4298heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4297heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5615heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5335heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5963heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5767heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4585heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4580heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4591heterozygoteVUS2- Undef
CF-causing- Undef
CF 4605heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4596heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4560heterozygoteCF-causing- Undef
likely CF- Undef
CF 4347heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4335heterozygoteCF-causing- Undef
likely CF- Undef
CF 4807heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4406heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 4480heterozygoteCF-causing- Undef
VUS2- Undef
CF 4538heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 4535heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4486heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2998heterozygoteCFTR-RD-causing - Cis
CF-causing - Cis
CF-causing - Trans
CF 2994heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2986heterozygoteCF-causing - Cis
CF-causing - Trans
CF 2985heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3057heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3142heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 5064heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3077heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3070heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2947heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2889heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
CF 2880heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2850heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 2842heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2830heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2797heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2893heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 2897heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2770heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5006heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5168heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
VUS3- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4765heterozygoteVUS3- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 3243heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5066heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3215heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3212heterozygoteCF-causing- Undef
likely CF- Undef
CF 3205heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 3282heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3180heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1011heterozygoteCF-causing- Undef
CF-causing- Undef
CF 380heterozygoteCF-causing- Undef
CF-causing- Undef
CF 374heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 368heterozygoteCF-causing - Cis
CF-causing - Trans
CF 365heterozygoteCF-causing - Cis
CF-causing - Trans
CF 363heterozygoteCF-causing - Cis
CF-causing - Trans
CF 360heterozygoteCF-causing - Cis
CF-causing - Trans
CF 357heterozygoteCF-causing - Cis
CF-causing - Trans
CF 382heterozygoteVUS3 - Cis
VUS3 - Cis
CF-causing - Trans
CF 348heterozygoteCF-causing - Cis
CF-causing - Trans
CF 347heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 298heterozygoteCF-causing - Cis
CF-causing - Trans
CF 297heterozygoteCF-causing - Cis
VUS3 - Cis
CF-causing - Trans
CF 294heterozygoteVUS1- Undef
CF 292heterozygoteCF-causing - Cis
CF-causing - Trans
CF 290heterozygoteCF-causing- Undef
CF-causing- Undef
CF 289heterozygoteCF-causing- Undef
likely CF- Undef
CF 288heterozygoteCF-causing- Undef
CF-causing- Undef
CF 287heterozygoteCF-causing- Undef
CF-causing- Undef
CF 285heterozygoteCF-causing- Undef
CF-causing- Undef
CF 284heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 283heterozygoteCF-causing- Undef
CF-causing- Undef
CF 276heterozygoteCF-causing - Cis
CF-causing - Trans
CF 303heterozygoteCF-causing- Undef
CF-causing- Undef
CF 304heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3 - Trans
CF 305heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 340heterozygoteVUS1 - Cis
CF-causing - Cis
CF-causing - Trans
CF 338heterozygotelikely CF - Cis
CF-causing - Trans
CF 336heterozygoteCF-causing - Cis
CF-causing - Trans
CF 334heterozygoteCF-causing - Cis
CF-causing - Trans
CF 332heterozygoteCF-causing - Cis
CF-causing - Trans
CF 330heterozygoteCF-causing - Cis
CF-causing - Trans
CF 319heterozygoteCF-causing - Cis
CF-causing - Trans
CF 313heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CF 309heterozygoteCF-causing - Cis
CF-causing - Trans
CF 307heterozygoteCF-causing - Cis
CF-causing - Trans
CF 272heterozygoteCF-causing- Undef
CF-causing- Undef
CF 488heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 509heterozygoteCF-causing - Cis
CF-causing - Trans
CF 502heterozygoteCF-causing- Undef
CF-causing- Undef
CF 472heterozygoteCF-causing - Cis
CF-causing - Trans
CF 466heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3- Undef
CF 267heterozygoteCF-causing- Undef
CF-causing- Undef
CF 133heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4732heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4845heterozygoteCF-causing- Undef
CF-causing- Undef
CF 132heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3 - Trans
CF 130heterozygoteCF-causing- Undef
CF-causing- Undef
CF 126heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 121heterozygoteCF-causing - Cis
CF-causing - Trans
CF 2heterozygoteCF-causing - Cis
CF-causing - Trans
CF 113heterozygoteCF-causing - Cis
CF-causing - Trans
CF 111heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 100heterozygoteCF-causing- Undef
CF-causing- Undef
CF 97heterozygoteCF-causing- Undef
CF-causing- Undef
CF 96heterozygoteCF-causing - Cis
VUS2 - Trans
CF-causing - Trans
CF 92heterozygoteCF-causing - Cis
CF-causing - Trans
CF 89heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4719heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 51heterozygoteCF-causing - Cis
CF-causing - Trans
CF 47heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 45heterozygoteCF-causing - Cis
CF-causing - Trans
CF 19heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 12heterozygoteCF-causing - Cis
CF-causing - Trans
CF 11heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 6heterozygoteCF-causing - Cis
CF-causing - Trans
CF 266heterozygoteCF-causing- Undef
CF-causing- Undef
CF 234heterozygoteCF-causing- Undef
CF-causing- Undef
CF 230heterozygoteCF-causing- Undef
CF-causing- Undef
CF 229heterozygoteCF-causing- Undef
CF-causing- Undef
CF 225heterozygotelikely CF - Cis
CF-causing - Trans
CF 222heterozygoteCF-causing- Undef
CF-causing- Undef
CF 221heterozygoteCF-causing- Undef
CF-causing- Undef
CF 220heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 218heterozygoteCF-causing- Undef
CF-causing- Undef
CF 215heterozygoteVUS3 - Cis
CF-causing - Trans
CF 212heterozygoteCF-causing- Undef
CF-causing- Undef
CF 238heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 265heterozygoteCF-causing- Undef
CF-causing- Undef
CF 264heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 257heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 255heterozygoteCF-causing - Cis
CF-causing - Trans
CF 251heterozygoteCF-causing- Undef
CF-causing- Undef
CF 249heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 248heterozygoteCF-causing - Cis
CF-causing - Trans
CF 247heterozygoteCF-causing - Cis
VUS3 - Trans
CF 245heterozygoteCF-causing - Cis
CF-causing - Trans
VUS1 - Trans
VUS3 - Trans
CF 244heterozygoteCF-causing- Undef
CF-causing- Undef
CF 240heterozygoteCF-causing- Undef
CF-causing- Undef
CF 210heterozygoteCF-causing- Undef
CF-causing- Undef
CF 209heterozygoteCF-causing- Undef
CF-causing- Undef
CF 206heterozygoteCF-causing- Undef
CF 168heterozygoteCF-causing- Undef
CF 167heterozygoteCF-causing- Undef
CF-causing- Undef
CF 166heterozygoteCF-causing- Undef
CF-causing- Undef
CF 165heterozygoteCF-causing - Cis
CF-causing - Trans
CF 164heterozygoteCF-causing - Cis
CF-causing - Trans
CF 163heterozygoteCF-causing - Cis
CF-causing - Trans
CF 162heterozygoteCF-causing - Cis
CF-causing - Trans
CF 161heterozygoteCF-causing - Cis
CF-causing - Trans
CF 160heterozygoteCF-causing- Undef
CF-causing- Undef
CF 152heterozygoteCF-causing - Cis
CF-causing - Trans
CF 151heterozygoteCF-causing - Cis
CF-causing - Trans
CF 147heterozygoteCF-causing- Undef
CF-causing- Undef
CF 173heterozygoteCF-causing- Undef
CF-causing- Undef
CF 181heterozygoteCF-causing- Undef
CF-causing- Undef
CF 184heterozygoteCF-causing - Cis
CF-causing - Trans
CF 202heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
CF 201heterozygoteCF-causing- Undef
CF-causing- Undef
CF 199heterozygoteCF-causing- Undef
CF-causing- Undef
CF 196heterozygoteCF-causing- Undef
CF-causing- Undef
CF 195heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
CF 194heterozygoteCF-causing- Undef
CF-causing- Undef
CF 193heterozygoteCF-causing- Undef
CF-causing- Undef
CF 190heterozygoteCF-causing- Undef
CF-causing- Undef
CF 188heterozygoteCF-causing- Undef
likely CF- Undef
CF 187heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
CF 146heterozygoteCF-causing- Undef
CF-causing- Undef
CF 762heterozygoteCF-causing- Undef
CF-causing- Undef
CF 761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 758heterozygoteCF-causing - Cis
CF-causing - Trans
CF 928heterozygoteCF-causing - Cis
CF-causing - Trans
CF 800heterozygoteCF-causing - Cis
CF-causing - Trans
CF 795heterozygoteCF-causing - Cis
CF-causing - Trans
CF 787heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 714heterozygoteCF-causing - Cis
CF-causing - Trans
CF 711heterozygoteCF-causing- Undef
CF-causing- Undef
CF 703heterozygoteCF-causing- Undef
CF-causing- Undef
CF 696heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 733heterozygoteCF-causing- Undef
VUS3- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 744heterozygoteVUS3- Undef
CF 738heterozygoteCF-causing- Undef
CF-causing- Undef
CF 869heterozygoteCF-causing - Cis
CF-causing - Trans
CF 896heterozygoteCF-causing- Undef
CF-causing- Undef
CF 884heterozygoteCF-causing - Cis
CF-causing - Trans
CF 878heterozygoteCF-causing- Undef
CF-causing- Undef
CF 820heterozygoteCF-causing- Undef
CF-causing- Undef
CF 924heterozygoteCF-causing - Cis
CF-causing - Trans
CF 926heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 816heterozygoteCF-causing - Cis
CF-causing - Trans
CF 913heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 848heterozygoteCF-causing - Cis
CF-causing - Trans
CF 846heterozygoteCF-causing - Cis
CF-causing - Trans
CF 842heterozygoteCF-causing- Undef
CF-causing- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 596heterozygoteCF-causing- Undef
CF-causing- Undef
CF 576heterozygoteCF-causing- Undef
CF-causing- Undef
CF 969heterozygoteCF-causing - Cis
CF-causing - Trans
CF 570heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 597heterozygoteCF-causing- Undef
CF-causing- Undef
CF 623heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 622heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 617heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 579heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 600heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 567heterozygoteCF-causing - Cis
CF-causing - Trans
CF 970heterozygoteCF-causing - Cis
CF-causing - Trans
CF 989heterozygoteCF-causing- Undef
CF-causing- Undef
CF 994heterozygoteCF-causing - Cis
CF-causing - Trans
CF 998heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1004heterozygoteCF-causing - Cis
CF-causing - Trans
CF 564heterozygoteCF-causing - Cis
CF-causing - Trans
CF 561heterozygoteCF-causing - Cis
CF-causing - Trans
CF 559heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 631heterozygoteCF-causing- Undef
CF-causing- Undef
CF 953heterozygoteCF-causing- Undef
CF-causing- Undef
CF 957heterozygoteCF-causing - Cis
CF-causing - Trans
CF 668heterozygoteCF-causing- Undef
CF-causing- Undef
CF 688heterozygoteCF-causing - Cis
CF-causing - Trans
CF 666heterozygoteCF-causing - Cis
VUS3 - Cis
CF-causing - Trans
CF 672heterozygoteCF-causing - Cis
CF-causing - Trans
CF 686heterozygoteVUS3- Undef
CF 683heterozygoteCF-causing- Undef
CF-causing- Undef
CF 681heterozygoteCF-causing - Cis
CF-causing - Trans
CF 680heterozygoteCF-causing- Undef
likely CF- Undef
CF 642heterozygoteCF-causing - Cis
CF-causing - Trans
CF 652heterozygoteCF-causing- Undef
CF-causing- Undef
CF 636heterozygoteCF-causing - Cis
CF-causing - Trans
CF 651heterozygoteCF-causing- Undef
CF-causing- Undef
CF 114homozygotec.1210-12T[5] - Trans
c.1745C>T - p.(Thr582Ile) - Trans
CF 999homozygotec.579+1G>T - p.(=) - Trans
CF 4739homozygotec.3873+1G>A - p.(=) - Trans
c.3889dup - p.(Ser1297Phefs*5) - Trans
CF 4797homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3160C>G - p.(His1054Asp) - Trans
CF 4778homozygotec.1040G>A - p.(Arg347His) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 4782homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CF 4796homozygotec.*133T>A - p.(=) - Trans
c.1624G>T - p.(Gly542*) - Trans
c.54-589A>G - p.(=) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 976homozygotec.1766+5G>A - p.(=) - Trans
c.579+1G>T - p.(=) - Trans
CF 4785homozygotec.1040G>A - p.(Arg347His) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 1537homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2930C>T - p.(Ser977Phe) - Trans
CF 371homozygotec.2128A>T - p.(Lys710*) - Trans
c.948del - p.(Phe316Leufs*12) - Trans
CF 692homozygotec.4168C>T - p.(Gln1390*) - Trans
CF 354homozygotec.3310G>T - p.(Glu1104*) - Trans
CF 2375homozygotec.2989-449_3468+644del - p.(Leu997_Leu1156del) - Trans
CF 718homozygotec.1673T>C - p.(Leu558Ser) - Trans
c.579+1G>T - p.(=) - Trans
CF 1247homozygotec.1517T>C - p.(Ile506Thr) - Trans
CF 1246homozygotec.3310G>T - p.(Glu1104*) - Trans
CF 1230homozygotec.1000C>T - p.(Arg334Trp) - Trans
CF 1174homozygotec.3883del - p.(Ile1295Phefs*33) - Trans
CF 204homozygotec.3285A>T - p.(=) - Trans
c.54-5811_164+2186delins182 - p.? - Trans
c.658C>T - p.(Gln220*) - Trans
CF 5574homozygotec.1043T>A - p.(Met348Lys) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.2735C>A - p.(Ser912*) - Trans
CF 180homozygotec.3468G>A - p.(=) - Trans
c.579+1G>T - p.(=) - Trans
CF 179homozygotec.2583del - p.(Phe861Leufs*3) - Trans
CF 172homozygotec.254G>A - p.(Gly85Glu) - Trans
CF 1251homozygotec.328G>C - p.(Asp110His) - Trans
c.54-5811_164+2186delins182 - p.? - Trans
CF 4858homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 4867homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.254G>A - p.(Gly85Glu) - Trans
CF 4764homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1670del - p.(Ser557Phefs*2) - Trans
CF 299homozygotec.178G>A - p.(Glu60Lys) - Trans
c.2658-1G>C - p.(=) - Trans
CF 286homozygotec.579+1G>T - p.(=) - Trans
CF 804homozygotec.1000C>T - p.(Arg334Trp) - Trans
c.1040G>C - p.(Arg347Pro) - Trans
CF 1261homozygotec.3310G>T - p.(Glu1104*) - Trans
CF 886homozygotec.3310G>T - p.(Glu1104*) - Trans
c.579+1G>T - p.(=) - Trans
CBAVD 1968heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1871heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2292heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2336heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1521heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CBAVD 1469heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 1461heterozygoteVUS3 - Cis
CF-causing - Trans
CBAVD 2504heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 2512heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2514heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2565heterozygoteCF-causing- Undef
CBAVD 2556heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 2531heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2398heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2437heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2400heterozygote
CBAVD 1067heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1066heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 1065heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1055heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1052heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 1048heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5234heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 1030heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
CBAVD 5809heterozygotelikely CFTR-RD- Undef
VUS3- Undef
CBAVD 4830heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5134heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5127heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5819heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4824heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1301heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1291heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1288heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1314heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1319heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1287heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 1284heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 1177heterozygotevarying clinical consequence- Undef
CBAVD 1243heterozygotelikely CFTR-RD- Undef
VUS3- Undef
VUS2- Undef
CBAVD 1244heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 1248heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 1272heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1269heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 1263heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CBAVD 1256heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4271heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4264heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4310heterozygoteCF-causing- Undef
CBAVD 4309heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 4291heterozygoteVUS3- Undef
CBAVD 4224heterozygoteVUS2- Undef
VUS3- Undef
CBAVD 5768heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4578heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4577heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4566heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4562heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4586heterozygoteCFTR-RD-causing- Undef
CBAVD 4599heterozygotevarying clinical consequence - Cis
CFTR-RD-causing - Cis
CFTR-RD-causing - Trans
CBAVD 4598heterozygoteCF-causing- Undef
VUS3- Undef
VUS2- Undef
CBAVD 4592heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4333heterozygotevarying clinical consequence- Undef
non-CF- Undef
CBAVD 4554heterozygoteVUS4- Undef
CBAVD 4552heterozygoteCF-causing- Undef
CBAVD 4543heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 4536heterozygoteCF-causing- Undef
CBAVD 4484heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 2949heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 3062heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 2869heterozygoteCF-causing- Undef
VUS2- Undef
CBAVD 3063heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4622heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5022heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 5015heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4755heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4754heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4753heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4650heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4624heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5969heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5968heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5592heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 3405heterozygoteVUS3 - Cis
CF-causing- Undef
CBAVD 3396heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 4750heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 3344heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 3332heterozygotevarying clinical consequence - Cis
varying clinical consequence - Trans
CBAVD 3201heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 3326heterozygoteCFTR-RD-causing- Undef
CBAVD 3310heterozygoteVUS3 - Cis
CF-causing- Undef
CBAVD 414heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 389heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CBAVD 412heterozygotelikely CFTR-RD - Cis
CF-causing - Trans
CBAVD 411heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 410heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 408heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 407heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 403heterozygoteVUS1 - Cis
CF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 402heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 401heterozygoteCF-causing - Trans
CBAVD 399heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 394heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 393heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 391heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
non-CF - Trans
CBAVD 526heterozygoteVUS3- Undef
CBAVD 495heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
VUS1 - Trans
CBAVD 494heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 492heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 486heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 485heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 483heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 479heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 478heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 477heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 476heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 473heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 498heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CBAVD 499heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 525heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 524heterozygoteCFTR-RD-causing- Undef
CBAVD 523heterozygotelikely CFTR-RD- Undef
varying clinical consequence- Undef
CBAVD 515heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 514heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 511heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 510heterozygoteCFTR-RD-causing- Undef
CBAVD 504heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 503heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 501heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 469heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 437heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CBAVD 435heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 432heterozygoteCF-causing - Trans
CBAVD 431heterozygote
CBAVD 429heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 428heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 427heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 425heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 424heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 421heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 419heterozygoteVUS3- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 444heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 446heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 447heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 465heterozygoteCFTR-RD-causing - Cis
VUS3 - Cis
CF-causing - Trans
CBAVD 463heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 461heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 460heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 458heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 455heterozygoteCFTR-RD-causing- Undef
CBAVD 454heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 453heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 451heterozygotelikely CFTR-RD - Cis
CF-causing - Trans
VUS3 - Trans
CBAVD 450heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 448heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 416heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4740heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 4735heterozygoteVUS3- Undef
varying clinical consequence- Undef
CBAVD 413heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4727heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4717heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4683heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4682heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
CBAVD 4669heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 4707heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4703heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4699heterozygoteCFTR-RD-causing- Undef
VUS2- Undef
CF-causing- Undef
CBAVD 5072heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 527heterozygotevarying clinical consequence- Undef
CBAVD 927heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 774heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 770heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 755heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 792heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 781heterozygoteCFTR-RD-causing- Undef
CBAVD 931heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 751heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 746heterozygoteCFTR-RD-causing- Undef
CBAVD 938heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 712heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 698heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 737heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 736heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 690heterozygote
CBAVD 894heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 897heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 868heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 861heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 859heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 858heterozygote
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 873heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 875heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 892heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 891heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 890heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 895heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 876heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 849heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 904heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 819heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 818heterozygote
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 918heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 825heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 841heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 806heterozygoteVUS3- Undef
CBAVD 689heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 626heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 591heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 589heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 583heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 599heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 619heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 615heterozygote
CBAVD 605heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 565heterozygoteVUS3- Undef
VUS1- Undef
VUS3- Undef
CBAVD 988heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 532heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 530heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 529heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 541heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 544heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 528heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 665heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 664heterozygote
CBAVD 659heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 674heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 687heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 679heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 678heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 676heterozygoteCFTR-RD-causing- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 650heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 640heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 632heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 643heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 963heterozygoteCFTR-RD-causing- Undef
CBAVD 65homozygotec.1210-12T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 990homozygotec.1A>G - p.? - Trans
c.3454G>C - p.(Asp1152His) - Trans
CBAVD 5519homozygotec.1517T>C - p.(Ile506Thr) - Trans
c.601G>A - p.(Val201Met) - Trans
CBAVD 4595homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.3454G>C - p.(Asp1152His) - Trans
CBAVD 1025homozygotec.2936A>C - p.(Asp979Ala) - Trans
CBAVD 4589homozygotec.2991G>C - p.(Leu997Phe) - Trans
CBAVD 981homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2991G>C - p.(Leu997Phe) - Trans
CBAVD 531homozygotec.1210-34_1210-6TG[12]T[5] - Trans
CBAVD 580homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.1477C>T - p.(Gln493*) - Trans
CBAVD 612homozygotec.3454G>C - p.(Asp1152His) - Trans
c.366T>A - p.(Tyr122*) - Trans
CBAVD 445homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.579+1G>T - p.(=) - Trans
CBAVD 441homozygotec.1523T>G - p.(Phe508Cys) - Trans
c.1631G>T - p.(Gly544Val) - Trans
CBAVD 439homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2245C>T - p.(=) - Trans
c.2290C>T - p.(Arg764*) - Trans
CBAVD 418homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.3454G>C - p.(Asp1152His) - Trans
CBAVD 417homozygotec.1040G>A - p.(Arg347His) - Trans
c.3276C>A - p.(Tyr1092*) - Trans
CBAVD 660homozygotec.601G>A - p.(Val201Met) - Trans
CBAVD 406homozygote
CBAVD 405homozygotec.1210-34_1210-6TG[12]T[5] - Trans
CBAVD 697homozygotec.3454G>C - p.(Asp1152His) - Trans
c.601G>A - p.(Val201Met) - Trans
CBAVD 571homozygotec.1210-12T[5] - Trans
c.233dup - p.(Trp79Leufs*32) - Trans
CBAVD 481homozygotec.1210-12T[5] - Trans
c.1579_1584+11del - p.(Gln525Leufs*37) - Trans
CBAVD 482homozygotec.2991G>C - p.(Leu997Phe) - Trans
CBAVD 521homozygote
CBAVD 518homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.1820_1903del - p.(Met607_Gln634del) - Trans
CBAVD 536homozygote
CBAVD 513homozygotec.2991G>C - p.(Leu997Phe) - Trans
c.579+1G>T - p.(=) - Trans
CBAVD 537homozygotec.1210-12T[5] - Trans
c.54-5811_164+2186delins182 - p.? - Trans
CBAVD 538homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2991G>C - p.(Leu997Phe) - Trans
CBAVD 539homozygotec.1210-12T[5] - Trans
c.3731G>A - p.(Gly1244Glu) - Trans
CBAVD 507homozygotec.601G>A - p.(Val201Met) - Trans
CBAVD 543homozygotec.3196C>T - p.(Arg1066Cys) - Trans
c.601G>A - p.(Val201Met) - Trans
CBAVD 546homozygotec.1545_1546del - p.(Tyr515*) - Trans
c.349C>T - p.(Arg117Cys) - Trans
CBAVD 550homozygotec.3083T>G - p.(Met1028Arg) - Trans
c.3889dup - p.(Ser1297Phefs*5) - Trans
CBAVD 557homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.3700A>G - p.(Ile1234Val) - Trans
CBAVD 489homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2991G>C - p.(Leu997Phe) - Trans
CBAVD 707homozygotec.2991G>C - p.(Leu997Phe) - Trans
CBAVD 722homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.1A>G - p.? - Trans
CBAVD 823homozygote
CBAVD 5766homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 1242homozygotec.579+3A>G - p.(=) - Trans
CBAVD 5765homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1624G>T - p.(Gly542*) - Trans
CBAVD 1294homozygotec.2991G>C - p.(Leu997Phe) - Trans
c.601G>A - p.(Val201Met) - Trans
CBAVD 784homozygotec.1210-34_1210-6TG[12]T[5] - Trans
CBAVD 791homozygotec.3935A>G - p.(Asp1312Gly) - Trans
Asymptomatic compound heterozygote 4685heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 4840heterozygoteVUS1- Undef
Asymptomatic compound heterozygote 5073heterozygote
Asymptomatic compound heterozygote 314heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 370heterozygoteCF-causing- Undef
VUS2- Undef
Asymptomatic compound heterozygote 372heterozygoteCF-causing - Cis
VUS1 - Trans
Asymptomatic compound heterozygote 459heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 496heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
VUS1 - Trans
Asymptomatic compound heterozygote 558heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 796heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
non-CF- Undef
Asymptomatic compound heterozygote 922heterozygote
Asymptomatic compound heterozygote 932heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 1574heterozygotevarying clinical consequence - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 3031heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 3235heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4617heterozygoteVUS3 - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 4641heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 4656heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5167heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 5333heterozygotenon-CF- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5599heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5602heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 4289heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4303heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4422heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 4522heterozygoteCF-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4579heterozygoteVUS1- Undef
Asymptomatic compound heterozygote 4737homozygotec.1767-58G>C - p.(=) - Trans
c.3935A>G - p.(Asp1312Gly) - Trans
c.869+88T>A - p.(=) - Trans
Asymptomatic compound heterozygote 540homozygotec.1545_1546del - p.(Tyr515*) - Trans
c.349C>T - p.(Arg117Cys) - Trans
Asymptomatic compound heterozygote 575homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2991G>C - p.(Leu997Phe) - Trans
Asymptomatic compound heterozygote 5131homozygotec.-330T>G - p.(=) - Trans
c.2909-36T>G - p.(=) - Trans
Asymptomatic compound heterozygote 5222homozygotec.2989-422G>T - p.(?) - Trans
c.2991G>C - p.(Leu997Phe) - Trans
Asymptomatic compound heterozygote 5527homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.3718-24G>A - p.(=) - Trans
Asymptomatic compound heterozygote 5815homozygotec.2991G>C - p.(Leu997Phe) - Trans
Asymptomatic compound heterozygote 4763homozygotec.1521_1523del - p.(Phe508del) - Trans
Other 4676heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4690heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4702heterozygoteCF-causing- Undef
VUS3- Undef
Other 4705heterozygoteCF-causing- Undef
CF-causing- Undef
Other 4711heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4713heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Other 4714heterozygoteCF-causing- Undef
Other 4846heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 4844heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 186heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 358heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Other 645heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 756heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 757heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 779heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Other 789heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 845heterozygoteCF-causing- Undef
Other 851heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 937heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 972heterozygoteCF-causing - Trans
Other 980heterozygoteCFTR-RD-causing - Cis
varying clinical consequence - Cis
CF-causing - Trans
Other 4826heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 5087heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 5243heterozygoteVUS3- Undef
Other 5518heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 5128heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 4770heterozygoteCF-causing- Undef
VUS1- Undef
Other 4783heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Other 1061heterozygoteVUS2- Undef
Other 1073heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 1082heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 1098heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 1099heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1113heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Other 1123heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1134heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 1136heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1277heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Other 1305heterozygoteCF-causing- Undef
VUS1- Undef
Other 2277heterozygoteCF-causing- Undef
Other 2357heterozygoteCF-causing- Undef
Other 2433heterozygoteVUS3- Undef
Other 2696heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Other 2829heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4664heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4760heterozygoteVUS3- Undef
Other 4762heterozygoteVUS3- Undef
CF-causing- Undef
Other 2934heterozygoteCF-causing- Undef
Other 3046heterozygotelikely CFTR-RD- Undef
Other 3058heterozygoteCF-causing- Undef
CF-causing- Undef
Other 3076heterozygoteCF-causing- Undef
Other 3141heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5616heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Other 5163heterozygoteCF-causing- Undef
VUS3- Undef
Other 3660heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4317heterozygoteCF-causing- Undef
Other 4812heterozygoteCF-causing- Undef
VUS3- Undef
Other 4542heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4547heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4561heterozygoteCF-causing- Undef
non-CF- Undef
Other 4563heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Other 4567heterozygoteCF-causing- Undef
VUS3- Undef
Other 4572heterozygoteVUS2- Undef
Other 4587heterozygote
Other 4600heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 5075homozygotec.579+1G>T - p.(=) - Trans
c.601G>A - p.(Val201Met) - Trans
Other 315homozygotec.3454G>C - p.(Asp1152His) - Trans
c.346G>A - p.(Glu116Lys) - Trans
Other 4777homozygotec.1521_1523del - p.(Phe508del) - Trans
c.4127T>C - p.(Leu1376Ser) - Trans
Other 4800homozygotec.*1251C>T - p.(=) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.54-589A>G - p.(=) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Other 1124homozygotec.1210-12T[5] - Trans
Other 1158homozygotec.3276C>A - p.(Tyr1092*) - Trans
c.350G>A - p.(Arg117His) - Trans
Other 4530homozygotec.1054C>T - p.(Arg352Trp) - Trans
c.3038C>A - p.(Pro1013His) - Trans
Other 4537homozygotec.580-62T>G - p.(=) - Trans
Other 4568homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.2559T>C - p.(=) - Trans
Other 4582homozygotec.2991G>C - p.(Leu997Phe) - Trans
c.366T>A - p.(Tyr122*) - Trans
Bronchiectasis 4678heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4833heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5076heterozygoteVUS3- Undef
Bronchiectasis 560heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 879heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 899heterozygoteCF-causing- Undef
Bronchiectasis 921heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 950heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 966heterozygoteVUS3- Undef
VUS3- Undef
Bronchiectasis 5530heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4773heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Bronchiectasis 1090heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
Bronchiectasis 1110heterozygotelikely CFTR-RD- Undef
Bronchiectasis 1117heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 1120heterozygotevarying clinical consequence- Undef
Bronchiectasis 1237heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4848heterozygotevarying clinical consequence - Cis
CF-causing - Trans
Bronchiectasis 4868heterozygotevarying clinical consequence- Undef
CF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4870heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4866heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 1542heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2289heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2291heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2298heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2340heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2342heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2344heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2356heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 2368heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2373heterozygoteVUS3- Undef
Bronchiectasis 2406heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2415heterozygoteCF-causing- Undef
Bronchiectasis 2440heterozygoteCF-causing- Undef
Bronchiectasis 2446heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2454heterozygoteCF-causing- Undef
Bronchiectasis 2492heterozygoteCF-causing- Undef
Bronchiectasis 2502heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2522heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 2988heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CF-causing- Undef
Bronchiectasis 3038heterozygoteCFTR-RD-causing - Cis
Bronchiectasis 3219heterozygoteCFTR-RD-causing- Undef
VUS2- Undef
Bronchiectasis 3269heterozygoteCF-causing- Undef
Bronchiectasis 5331heterozygoteVUS3- Undef
Bronchiectasis 5618heterozygoteVUS3- Undef
Bronchiectasis 5624heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5950heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 5952heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5589heterozygoteCFTR-RD-causing - Cis
VUS3 - Trans
Bronchiectasis 4233heterozygoteVUS2- Undef
Bronchiectasis 4234heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 4295heterozygoteCF-causing- Undef
Bronchiectasis 4308heterozygote
Bronchiectasis 4314heterozygoteCF-causing- Undef
Bronchiectasis 4811heterozygoteCF-causing- Undef
Bronchiectasis 4816heterozygote
Bronchiectasis 4602heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4604heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4607heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4608heterozygotelikely CFTR-RD- Undef
CF-causing- Undef
Bronchiectasis 914homozygotec.1210-34_1210-6TG[12]T[5] - Trans
Pancreatitis 4692heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 4708heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 205heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 5070heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pancreatitis 648heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Pancreatitis 776heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 964heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5145heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 1168heterozygote
Pancreatitis 1524heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 2285heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2306heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2312heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2318heterozygote
Pancreatitis 2319heterozygote
Pancreatitis 2321heterozygote
Pancreatitis 2322heterozygote
Pancreatitis 2324heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2325heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2326heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2327heterozygote
Pancreatitis 2329heterozygoteVUS1- Undef
Pancreatitis 2334heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pancreatitis 2338heterozygoteVUS3- Undef
Pancreatitis 2364heterozygote
Pancreatitis 2377heterozygoteCF-causing- Undef
Pancreatitis 2408heterozygote
Pancreatitis 2417heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pancreatitis 2432heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2435heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2471heterozygoteVUS3- Undef
non-CF- Undef
Pancreatitis 2476heterozygoteCF-causing- Undef
Pancreatitis 2483heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2486heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CFTR-RD-causing- Undef
Pancreatitis 2488heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2511heterozygoteCF-causing- Undef
Pancreatitis 2581heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2591heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2302heterozygote
Pancreatitis 2748heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2786heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2811heterozygoteCFTR-RD-causing - Trans
Pancreatitis 2919heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Pancreatitis 2978heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3016heterozygotevarying clinical consequence - Trans
Pancreatitis 3023heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3044heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3061heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3182heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 3224heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 3232heterozygoteVUS1- Undef
Pancreatitis 3245heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4636heterozygoteCF-causing- Undef
non-CF- Undef
Pancreatitis 4639heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 3315heterozygoteVUS2- Undef
Pancreatitis 4642heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5007heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 3399heterozygote
Pancreatitis 5010heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5973heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5171heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5155heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5326heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 5329heterozygotevarying clinical consequence- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5339heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 5340heterozygoteVUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5608heterozygoteVUS3- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 5621heterozygote
Pancreatitis 5569heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4250heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4252heterozygote
Pancreatitis 4255heterozygote
Pancreatitis 4256heterozygote
Pancreatitis 4258heterozygote
Pancreatitis 4270heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 4273heterozygote
Pancreatitis 4280heterozygoteVUS3- Undef
Pancreatitis 4296heterozygote
Pancreatitis 4301heterozygote
Pancreatitis 4318heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 4343heterozygote
Pancreatitis 4559heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 4614heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
Pancreatitis 4565homozygotec.579+1G>T - p.(=) - Trans
Fetal bowel anomalies 4709heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 4738heterozygoteCFTR-RD-causing- Undef
Fetal bowel anomalies 366heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 545heterozygotevarying clinical consequence - Cis
Fetal bowel anomalies 578heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 677heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 828heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 1565heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 2388heterozygoteCF-causing- Undef
CF-causing- Undef
Fetal bowel anomalies 2397heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Fetal bowel anomalies 5604heterozygoteVUS3- Undef
Pending non-CF 4704heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending non-CF 753heterozygoteVUS3 - Cis
CF-causing - Trans
Pending non-CF 4825heterozygoteVUS3- Undef
varying clinical consequence- Undef
Pending (NBS) 4720heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 352heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Pending (NBS) 387heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 734heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 775heterozygoteCF-causing- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 951heterozygoteVUS2- Undef
CF-causing- Undef
likely CF- Undef
Pending (NBS) 991heterozygotevarying clinical consequence- Undef
Pending (NBS) 5089heterozygotevarying clinical consequence - Cis
CF-causing - Trans
Pending (NBS) 5533heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5816heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 1253heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
VUS3- Undef
Pending (NBS) 4852heterozygoteVUS3 - Cis
CF-causing - Trans
Pending (NBS) 1522heterozygoteCF-causing- Undef
non-CF- Undef
Pending (NBS) 1530heterozygoteVUS4 - Cis
CF-causing - Trans
Pending (NBS) 1566heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 1580heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 2940heterozygoteCF-causing- Undef
Pending (NBS) 4621heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 5313heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5310heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
Pending (NBS) 5327heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5773heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Pending (NBS) 5570heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5572heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4549heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 4555heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4569heterozygotevarying clinical consequence - Cis
CF-causing - Trans
Pending (NBS) 4593heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 4606heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4769homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 1307homozygotec.1769G>A - p.(Cys590Tyr) - Trans
c.3889dup - p.(Ser1297Phefs*5) - Trans
Pending 243heterozygote
Pending 312heterozygoteCFTR-RD-causing- Undef
Pending 907heterozygoteCF-causing- Undef
VUS3- Undef
Pending 5216heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending 1075heterozygoteCF-causing- Undef
Pending 1097heterozygoteVUS3 - Cis
varying clinical consequence - Trans
Pending 2944heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending 3035heterozygoteCF-causing- Undef
Pending 3073heterozygoteCF-causing- Undef
VUS3- Undef
Pending 3089heterozygote
Pending 3165heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending 4748heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending 4304heterozygoteVUS3 - Cis
Pending 4336heterozygoteCF-causing- Undef
Pending 4337heterozygoteCF-causing- Undef
VUS3- Undef
Pending 1240homozygotec.2991G>C - p.(Leu997Phe) - Trans
CRS-NP 349heterozygoteCF-causing - Cis
VUS1- Undef
CRS-NP 910heterozygoteCF-causing- Undef
CRS-NP 5531heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CRS-NP 1239heterozygoteCF-causing- Undef
CRS-NP 3126heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CRS-NP 3284heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CRS-NP 5338heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CRS-NP 4805heterozygote
CRS-NP 295homozygotec.254G>A - p.(Gly85Glu) - Trans
c.481T>A - p.(Tyr161Asn) - Trans
CRS-NP 5130homozygotec.14C>T - p.(Pro5Leu) - Trans
CRS-NP 4768homozygotec.1040G>C - p.(Arg347Pro) - Trans
c.3276C>A - p.(Tyr1092*) - Trans
Aquagenic palmoplantar keratoderma 4827heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Aquagenic palmoplantar keratoderma 5613heterozygotenon-CF- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare