Variant NM_000492.4:c.1523T>G


Variant details:
Name NM_000492.4:c.1523T>G
Protein name NP_000483.3:p.(Phe508Cys)
Genomic name (hg19)     chr7:g.117199648T>G    UCSC    
Genomic name (hg38) chr7:g.117559594T>G    UCSC
#Exon/intron exon 11
Legacy Name F508C
Class disease-causing
Subclass CFTR-RD-causing
complex allele in 14.89% of patients associated with
  • c.3752G>A - p.(Ser1251Asn) : 100.00%
    • WT sequence GGCACCATTAAAGAAAATATCATCT T TGGTGTTTCCTATGATGAATATAGA
    Mutant sequence GGCACCATTAAAGAAAATATCATCT G TGGTGTTTCCTATGATGAATATAGA

    Other databases:
    dbSNP
    rs74571530



    Pathogenicity predictors:

    Functional studies:         +


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Gregory et al, 1991 1712898 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:         +


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnoyesno
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno
    VNZ-TEZ-DIVA yesnoyesno

    clinical and functional data presented above are provided by Vertex


    1 individuals carrying this variant are reported in CFTR-NGS catalogue


    47 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 47
    Asymptomatic compound heterozygote 3
    CF 8
    CFTR-RD35
    • Bronchiectasis  3
    • CBAVD  23
    • CRS-NP  1
    • Other  2
    • Pancreatitis  6
    Pending (NBS) 1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CBAVD 2531heterozygoteCF-causing - Trans
    CBAVD 5451heterozygoteCF-causing - Trans
    CBAVD 4624heterozygoteCF-causing - Trans
    CBAVD 4753heterozygoteCF-causing- Undef
    CBAVD 5968heterozygoteCF-causing - Trans
    CBAVD 3396heterozygoteCF-causing - Trans
    CBAVD 3344heterozygoteCF-causing - Trans
    CBAVD 1871heterozygoteVUS3- Undef
    CBAVD 687heterozygoteCF-causing - Trans
    CBAVD 678heterozygoteCF-causing- Undef
    CBAVD 515heterozygoteCF-causing - Trans
    CBAVD 453heterozygoteCF-causing - Trans
    CBAVD 441heterozygotelikely CFTR-RD - Trans
    CBAVD 4710heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 712heterozygoteCF-causing - Trans
    CBAVD 810heterozygoteVUS2- Undef
    CF-causing- Undef
    CBAVD 5471heterozygoteCF-causing - Trans
    CBAVD 1319heterozygoteCF-causing- Undef
    CBAVD 1256heterozygoteCF-causing- Undef
    CBAVD 5127heterozygoteCF-causing- Undef
    CBAVD 4830heterozygoteCF-causing - Trans
    CBAVD 895heterozygoteCF-causing - Trans
    CBAVD 4669heterozygoteCF-causing - Trans
    Other 6218heterozygoteCF-causing - Trans
    Other 4844heterozygoteCF-causing - Trans
    CF 2850heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 2735heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 2343heterozygoteCF-causing - Trans
    CF 2854heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 2998heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 313heterozygoteCF-causing - Trans
    varying clinical consequence- Undef
    CF 88heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 696heterozygoteCF-causing - Cis
    CF-causing - Trans
    Bronchiectasis 3219heterozygoteVUS2- Undef
    Bronchiectasis 2988heterozygoteCF-causing - Cis
    varying clinical consequence - Trans
    Bronchiectasis 5530heterozygoteCFTR-RD-causing- Undef
    Asymptomatic compound heterozygote 4303heterozygote
    Asymptomatic compound heterozygote 5306heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 5942heterozygoteCF-causing - Trans
    CRS-NP 6336heterozygoteCF-causing- Undef
    varying clinical consequence- Undef
    Pancreatitis 2581heterozygote
    Pancreatitis 2521heterozygote
    Pancreatitis 2369heterozygote
    Pancreatitis 3245heterozygoteCF-causing - Trans
    Pancreatitis 5097heterozygoteVUS3 - Trans
    Pancreatitis 1856heterozygoteCF-causing- Undef
    Pending (NBS) 5305heterozygoteCF-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups (click here for more details about the classification of variants):
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare