Variant NM_000492.4:c.1584G>A


Variant details:
Name NM_000492.4:c.1584G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117199709G>A    UCSC    
#Exon/intron exon 11
Legacy Name E528E (1716G/A)
Class non disease-causing
WT sequence TCATCAAAGCATGCCAACTAGAAGA G GTAAGAAACTATGTGAAAACTTTTT
Mutant sequence TCATCAAAGCATGCCAACTAGAAGA A GTAAGAAACTATGTGAAAACTTTTT

Other databases:
dbSNP
rs1800095







Pathogenicity predictors:

Not found

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Bergougnoux et al, 2015 25797027 ✓ ✓ ✓


« ✓ » indicates the type of analysis performed and not the results




6 individuals carrying this variant are reported in CFTR-NGS catalogue


59 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 59
Asymptomatic compound heterozygote 2
CF 5
CFTR-RD47
  • Bronchiectasis  4
  • CBAVD  9
  • Other  4
  • Pancreatitis  30
Fetal bowel anomalies 2
Pending 2
Pending non-CF 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 984heterozygoteCF-causing - Cis
CF-causing - Trans
CF 691heterozygoteCF-causing - Cis
CF-causing - Trans
CF 642heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1932heterozygoteCF-causing- Undef
CF-causing- Undef
CF 140heterozygoteCF-causing - Cis
CF-causing - Trans
Pending 2360heterozygoteCFTR-RD-causing- Undef
Pending 312heterozygoteCFTR-RD-causing- Undef
Other 4809heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
Other 4625heterozygoteVUS3- Undef
Other 464heterozygoteVUS3- Undef
CF-causing- Undef
Other 1265heterozygoteCF-causing- Undef
CBAVD 4554heterozygoteVUS4- Undef
CBAVD 4883heterozygoteVUS3- Undef
CBAVD 4532heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 3326heterozygoteCFTR-RD-causing- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 524heterozygoteCFTR-RD-causing- Undef
CBAVD 500heterozygotenon-CF- Undef
CF-causing- Undef
CBAVD 1508heterozygoteVUS3 - Cis
CF-causing - Trans
CBAVD 1446heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 771heterozygoteCF-causing - Trans
Fetal bowel anomalies 545heterozygotevarying clinical consequence - Trans
Asymptomatic compound heterozygote 4961heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 766heterozygoteCF-causing - Trans
Pancreatitis 2527heterozygoteVUS3- Undef
Pancreatitis 2471heterozygoteVUS3- Undef
non-CF- Undef
Pancreatitis 2462heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2431heterozygote
Pancreatitis 2422heterozygote
Pancreatitis 2418heterozygoteVUS3- Undef
Pancreatitis 2414heterozygote
Pancreatitis 2389heterozygoteVUS3- Undef
Pancreatitis 2321heterozygote
Pancreatitis 2319heterozygote
Pancreatitis 2305heterozygoteVUS3- Undef
Pancreatitis 4913heterozygoteVUS3- Undef
non-CF- Undef
Pancreatitis 4916heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 4296heterozygote
Pancreatitis 4256heterozygote
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 5171heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 2652heterozygotevarying clinical consequence- Undef
Pancreatitis 2286heterozygoteCF-causing- Undef
Pancreatitis 2285heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2193heterozygote
Pancreatitis 1044heterozygotevarying clinical consequence - Trans
Pancreatitis 1161heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 2185heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2100heterozygote
Pancreatitis 2098heterozygote
Pancreatitis 2005heterozygoteVUS1- Undef
Pancreatitis 1961heterozygoteCFTR-RD-causing- Undef
Pancreatitis 1925heterozygoteVUS3- Undef
Pancreatitis 5058heterozygoteCF-causing- Undef
Bronchiectasis 4474heterozygotevarying clinical consequence- Undef
Bronchiectasis 1120heterozygotevarying clinical consequence- Undef
Bronchiectasis 2108heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 1921heterozygoteCFTR-RD-causing- Undef
Pending non-CF 5009heterozygoteVUS3- Undef
CF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare