Variant NM_000492.4:c.1584G>A
Name | NM_000492.4:c.1584G>A |
Protein name | NP_000483.3:p.(=) |
Genomic name (hg19) | chr7:g.117199709G>A UCSC |
#Exon/intron | exon 11 |
Legacy Name | E528E (1716G/A) |
Class | non disease-causing |
WT sequence | TCATCAAAGCATGCCAACTAGAAGA G GTAAGAAACTATGTGAAAACTTTTT |
Mutant sequence | TCATCAAAGCATGCCAACTAGAAGA A GTAAGAAACTATGTGAAAACTTTTT |
dbSNP rs1800095 |
Not found |
Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
Bergougnoux et al, 2015 | 25797027 | ✓ | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
6 individuals carrying this variant are reported in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 59 |
---|---|
Asymptomatic compound heterozygote | 2 |
CF | 5 |
CFTR-RD | 47
|
Fetal bowel anomalies | 2 |
Pending | 2 |
Pending non-CF | 1 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CF | 984 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 691 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 642 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 1932 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 140 | heterozygote | CF-causing - Cis CF-causing - Trans |
Pending | 2360 | heterozygote | |
Pending | 312 | heterozygote | CFTR-RD-causing- Undef |
Other | 4809 | heterozygote | VUS3- Undef CF-causing- Undef |
Other | 4625 | heterozygote | VUS3- Undef |
Other | 464 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Other | 1265 | heterozygote | CF-causing- Undef |
CBAVD | 4554 | heterozygote | VUS4- Undef |
CBAVD | 4883 | heterozygote | VUS3- Undef |
CBAVD | 4532 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3326 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 524 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 500 | heterozygote | non-CF- Undef CF-causing- Undef |
CBAVD | 1508 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
CBAVD | 1446 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
Fetal bowel anomalies | 771 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 545 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 4961 | heterozygote | CF-causing- Undef |
Asymptomatic compound heterozygote | 766 | heterozygote | CF-causing - Trans |
Pancreatitis | 2527 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2471 | heterozygote | VUS3- Undef non-CF- Undef |
Pancreatitis | 2462 | heterozygote | |
Pancreatitis | 2431 | heterozygote | |
Pancreatitis | 2422 | heterozygote | |
Pancreatitis | 2418 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2414 | heterozygote | |
Pancreatitis | 2389 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2321 | heterozygote | |
Pancreatitis | 2319 | heterozygote | |
Pancreatitis | 2305 | heterozygote | VUS3- Undef |
Pancreatitis | 4913 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
Pancreatitis | 4916 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
Pancreatitis | 4296 | heterozygote | |
Pancreatitis | 4256 | heterozygote | |
Pancreatitis | 5614 | heterozygote | VUS3- Undef |
Pancreatitis | 5171 | heterozygote | VUS3- Undef VUS3- Undef |
Pancreatitis | 2652 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 2286 | heterozygote | CF-causing- Undef |
Pancreatitis | 2285 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2193 | heterozygote | |
Pancreatitis | 1044 | heterozygote | varying clinical consequence - Trans |
Pancreatitis | 1161 | heterozygote | CF-causing- Undef VUS3- Undef |
Pancreatitis | 2185 | heterozygote | |
Pancreatitis | 2100 | heterozygote | |
Pancreatitis | 2098 | heterozygote | |
Pancreatitis | 2005 | heterozygote | VUS1- Undef |
Pancreatitis | 1961 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 1925 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5058 | heterozygote | CF-causing- Undef |
Bronchiectasis | 4474 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 1120 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 2108 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 1921 | heterozygote | CFTR-RD-causing- Undef |
Pending non-CF | 5009 | heterozygote | VUS3- Undef CF-causing- Undef |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|