Variant NM_000492.4:c.1585-1G>A


Variant details:
Name NM_000492.4:c.1585-1G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117227792G>A    UCSC    
#Exon/intron intron 11
Legacy Name 1717-1G>A
Class disease-causing
Subclass CF-causing
WT sequence CTCTAATTTTCTATTTTTGGTAATA G GACATCTCCAAGTTTGCAGAGAAAG
Mutant sequence CTCTAATTTTCTATTTTTGGTAATA A GACATCTCCAAGTTTGCAGAGAAAG

Other databases:
dbSNP
rs76713772







Pathogenicity predictors:

Not found





1 individuals carrying this variant are reported in CFTR-NGS catalogue


99 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 99
Asymptomatic compound heterozygote 2
CF 78
CFTR-RD13
  • Bronchiectasis  1
  • CBAVD  11
  • Pancreatitis  1
Fetal bowel anomalies 3
Pending (NBS) 3




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 2904heterozygoteCF-causing - Trans
CF 2974heterozygoteCF-causing - Trans
CF 2975heterozygoteCF-causing - Trans
CF 3004heterozygoteCF-causing - Trans
CF 3008heterozygoteCF-causing- Undef
CF 3048heterozygoteCF-causing - Trans
CF 3144heterozygoteCF-causing - Trans
CF 3145heterozygoteCF-causing - Trans
CF 3149heterozygoteCF-causing - Trans
CF 3195heterozygoteCF-causing- Undef
CF 2903heterozygoteCF-causing - Trans
CF 2870heterozygoteCF-causing - Trans
CF 2561heterozygoteCF-causing- Undef
CF 4909heterozygoteCF-causing - Trans
CF 2621heterozygoteCF-causing- Undef
CF 2651heterozygoteCF-causing- Undef
CF 2702heterozygoteVUS3 - Trans
CF 2703heterozygoteVUS3 - Trans
CF 2741heterozygoteCF-causing - Trans
CF 2862heterozygoteCF-causing - Trans
CF 3199heterozygoteCF-causing - Trans
CF 3294heterozygoteCF-causing - Trans
CF 3867heterozygoteCF-causing- Undef
CF 4046heterozygoteCF-causing- Undef
CF 4099heterozygoteCF-causing- Undef
CF 4117heterozygoteCF-causing - Trans
CF 5756heterozygoteVUS3- Undef
CF 4452heterozygoteCF-causing- Undef
CF 4516heterozygoteCF-causing - Trans
CF 6012heterozygotevarying clinical consequence- Undef
CF 3854heterozygoteCF-causing - Trans
CF 3853heterozygoteCF-causing - Trans
CF 3336heterozygoteCF-causing - Trans
CF 3337heterozygoteCF-causing - Trans
CF 3398heterozygoteCF-causing- Undef
CF 3460heterozygoteCF-causing- Undef
CF 3469heterozygoteCF-causing- Undef
CF 3678heterozygoteCF-causing - Trans
CF 3720heterozygoteCF-causing - Trans
CF 3797heterozygoteCF-causing- Undef
CF 3851heterozygoteCF-causing- Undef
CF 2362heterozygoteCF-causing- Undef
CF 7heterozygoteCF-causing - Trans
CF 704heterozygoteCF-causing - Trans
CF 773heterozygoteCF-causing - Trans
CF 936heterozygoteCF-causing - Trans
CF 1021heterozygoteCF-causing - Trans
CF 4775heterozygoteCF-causing- Undef
CF 1047heterozygoteCF-causing - Trans
CF 348heterozygoteCF-causing - Trans
CF 17heterozygoteCF-causing - Trans
CF 63heterozygoteCF-causing - Trans
CF 281heterozygoteCF-causing - Trans
CF 282heterozygotevarying clinical consequence- Undef
CF 305heterozygoteCFTR-RD-causing- Undef
CF 327heterozygoteCF-causing - Trans
CF 4793heterozygoteCF-causing- Undef
CF 1092heterozygoteCF-causing- Undef
CF 5032heterozygotevarying clinical consequence- Undef
CF 1822heterozygoteCF-causing- Undef
CF 1839heterozygoteCF-causing- Undef
CF 1975heterozygoteCF-causing- Undef
CF 2042heterozygoteCF-causing- Undef
CF 2046heterozygoteCF-causing- Undef
CF 2083heterozygoteCF-causing- Undef
CF 2191heterozygoteCF-causing- Undef
CF 2199heterozygoteCF-causing- Undef
CF 1738heterozygoteCF-causing- Undef
CF 1713heterozygoteCF-causing- Undef
CF 1678heterozygoteCF-causing- Undef
CF 1203heterozygoteCF-causing - Trans
CF 1231heterozygoteCF-causing - Trans
CF 4856heterozygoteCF-causing- Undef
CF 1557heterozygoteCF-causing - Trans
CF 1604heterozygoteCF-causing- Undef
CF 1622heterozygoteCF-causing- Undef
CF 2297heterozygoteCF-causing - Trans
CF 1013homozygotec.1585-1G>A - p.(=) - Trans
Fetal bowel anomalies 4086heterozygoteCF-causing- Undef
Fetal bowel anomalies 4670heterozygoteCF-causing - Trans
Fetal bowel anomalies 323heterozygoteCF-causing - Trans
CBAVD 4928heterozygoteCFTR-RD-causing- Undef
CBAVD 3310heterozygoteVUS3- Undef
CBAVD 3405heterozygoteVUS3- Undef
CBAVD 551heterozygoteCFTR-RD-causing- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CBAVD 5127heterozygoteCFTR-RD-causing- Undef
CBAVD 5229heterozygoteCFTR-RD-causing - Trans
CBAVD 461heterozygoteCFTR-RD-causing- Undef
CBAVD 4727heterozygoteCFTR-RD-causing - Trans
CBAVD 1330heterozygoteCFTR-RD-causing- Undef
CBAVD 1462heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 2863heterozygote
Asymptomatic compound heterozygote 4728heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 1118heterozygoteCF-causing - Trans
Pending (NBS) 4569heterozygotevarying clinical consequence - Trans
Pending (NBS) 6193heterozygotevarying clinical consequence- Undef
Pending (NBS) 5291heterozygoteVUS3 - Trans
Pancreatitis 2377heterozygote


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare