Updates for c.1609G>A:
2022-10-24 Classe updated from VUS to disease-causing, subclass undefined




Variant NM_000492.4:c.1609G>A


Variant details:
Name NM_000492.4:c.1609G>A
Protein name NP_000483.3:p.(Asp537Asn)
Genomic name (hg19)     chr7:g.117227817G>A    UCSC    
Genomic name (hg38) chr7:g.117587763G>A    UCSC
#Exon/intron exon 12
Legacy Name D537N
Class disease-causing
WT sequence GGACATCTCCAAGTTTGCAGAGAAA G ACAATATAGTTCTTGGAGAAGGTGG
Mutant sequence GGACATCTCCAAGTTTGCAGAGAAA A ACAATATAGTTCTTGGAGAAGGTGG

Other databases:

Not found
Not found		dbSNP
no rs



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Hatton et al., 2022 34949556 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


1 individuals carrying this variant are reported in CFTR-NGS catalogue

No patient found in CFTR-France




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare