Variant NM_000492.4:c.1652G>A


Variant details:
Name NM_000492.4:c.1652G>A
Protein name NP_000483.3:p.(Gly551Asp)
Genomic name (hg19) chr7:g.117227860G>A    UCSC    
#Exon/intron exon 12
Legacy Name G551D
Class disease-causing
Subclass CF-causing
WT sequence GAAGGTGGAATCACACTGAGTGGAG G TCAACGAGCAAGAATTTCTTTAGCA
Mutant sequence GAAGGTGGAATCACACTGAGTGGAG A TCAACGAGCAAGAATTTCTTTAGCA

Other databases:
dbSNP
rs75527207



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Gregory et al, 1991 1712898 ✓ ✓
Yu et al, 2012 22293084 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓
Bergougnoux et al, 2015 25797027 ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yes yesno yes
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


3 individuals carrying this variant are reported in CFTR-NGS catalogue


95 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 95
Asymptomatic compound heterozygote 3
CF 73
CFTR-RD10
  • Bronchiectasis  1
  • CBAVD  4
  • Other  3
  • Pancreatitis  2
Pending 3
Pending (NBS) 6




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1378heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 1478heterozygoteCF-causing - Cis
non-CF- Undef
CBAVD 2353heterozygoteCF-causing - Cis
varying clinical consequence- Undef
Pending (NBS) 3676heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 3655heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 4030heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 3958heterozygoteCF-causing - Cis
non-CF - Trans
Pending (NBS) 4821heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 562heterozygoteCF-causing - Cis
VUS3 - Trans
CF 3431heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3661heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3717heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3739heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3770heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3777heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3792heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3803heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3858heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3656heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3653heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3470heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3493heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3506heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3524heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3564heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3565heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3575heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3576heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3585heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3861heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3875heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4090heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4091heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4166heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4189heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5783heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 4427heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4434heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4056heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4050heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3892heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3904heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3912heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3936heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3937heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3944heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3951heterozygoteCF-causing - Cis
CF-causing- Undef
CF 3995heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4510heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4780heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1164heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1201heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1303heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1608heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1622heterozygoteCF-causing - Cis
CF-causing- Undef
CF 5512heterozygoteCF-causing - Cis
CF-causing - Trans
CF 183heterozygoteCF-causing - Cis
CF-causing - Trans
CF 242heterozygoteCF-causing- Undef
CF-causing- Undef
CF 365heterozygoteCF-causing - Cis
CF-causing - Trans
CF 368heterozygoteCF-causing - Cis
CF-causing - Trans
CF 729heterozygoteCF-causing - Cis
CF-causing - Trans
CF 956heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1623heterozygoteCF-causing - Cis
CF-causing- Undef
CF 1677heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2589heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2598heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2729heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2773heterozygoteCF-causing - Cis
CF-causing - Trans
CF 2810heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3005heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3120heterozygoteCF-causing - Cis
CFTR-RD-causing- Undef
CF 5777heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
VUS3 - Trans
CF 2426heterozygoteCF-causing - Cis
varying clinical consequence- Undef
CF 4988heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 1889heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1903heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1994heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2250heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3570homozygotec.1652G>A - p.(Gly551Asp) - Trans
CF 4408homozygotec.1652G>A - p.(Gly551Asp) - Trans
CF 1820homozygotec.1652G>A - p.(Gly551Asp) - Trans
CF 3591homozygotec.1652G>A - p.(Gly551Asp) - Trans
Asymptomatic compound heterozygote 385heterozygoteCF-causing - Cis
VUS3 - Trans
Asymptomatic compound heterozygote 574heterozygoteCF-causing - Cis
VUS3 - Trans
Asymptomatic compound heterozygote 3148heterozygoteCF-causing - Cis
VUS2 - Trans
Other 4458heterozygoteCF-causing - Cis
Other 1283heterozygoteCF-causing- Undef
Other 5522heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 1237heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 4890heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 5371heterozygoteCF-causing - Cis
VUS2- Undef
Pending 4505heterozygoteCF-causing - Cis
Pending 2447heterozygoteCF-causing - Cis
varying clinical consequence- Undef
Pending 5868heterozygoteCF-causing - Cis
varying clinical consequence- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare