Variant NM_000492.4:c.1657C>T


Variant details:
Name NM_000492.4:c.1657C>T
Protein name NP_000483.3:p.(Arg553*)
Genomic name (hg19) chr7:g.117227865C>T    UCSC    
#Exon/intron exon 12
Legacy Name R553X
Class disease-causing
Subclass CF-causing
WT sequence TGGAATCACACTGAGTGGAGGTCAA C GAGCAAGAATTTCTTTAGCAAGGTG
Mutant sequence TGGAATCACACTGAGTGGAGGTCAA T GAGCAAGAATTTCTTTAGCAAGGTG

Other databases:
dbSNP
rs397508148







Pathogenicity predictors:

Not found





5 individuals carrying this variant are reported in CFTR-NGS catalogue


81 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 81
Asymptomatic compound heterozygote 1
CF 56
CFTR-RD19
  • Bronchiectasis  1
  • CBAVD  10
  • CRS-NP  1
  • Other  6
  • Pancreatitis  1
Fetal bowel anomalies 2
Pending (NBS) 3




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3193heterozygoteCF-causing - Trans
CF 3223heterozygotevarying clinical consequence- Undef
CF 3228heterozygotevarying clinical consequence - Trans
CF 3251heterozygoteCF-causing - Trans
CF 3255heterozygoteCF-causing - Trans
CF 3169heterozygoteCF-causing - Trans
CF 3164heterozygoteCF-causing - Trans
CF 2859heterozygoteCF-causing - Trans
CF 2961heterozygoteCF-causing - Trans
CF 3029heterozygoteCF-causing - Trans
CF 3066heterozygoteCF-causing - Trans
CF 3123heterozygoteCF-causing - Trans
CF 3150heterozygoteCF-causing - Trans
CF 3262heterozygoteCF-causing - Trans
CF 3297heterozygoteCF-causing - Trans
CF 3746heterozygoteCF-causing- Undef
CF 4006heterozygoteCF-causing- Undef
CF 4063heterozygoteCF-causing - Trans
CF 4225heterozygoteCF-causing- Undef
CF 4327heterozygotelikely CF - Trans
CF 4380heterozygoteCF-causing- Undef
CF 4440heterozygoteCF-causing - Trans
CF 4544heterozygoteCF-causing- Undef
CF 3571heterozygoteCF-causing - Trans
CF 3485heterozygoteCF-causing- Undef
CF 3320heterozygoteCF-causing - Trans
CF 3378heterozygoteCF-causing - Trans
CF 3408heterozygoteCF-causing - Trans
CF 3413heterozygoteCF-causing - Trans
CF 3457heterozygoteCF-causing- Undef
CF 2836heterozygoteCF-causing - Trans
CF 2828heterozygoteCF-causing - Trans
CF 955heterozygoteCF-causing - Trans
CF 1011heterozygoteCF-causing - Trans
CF 1031heterozygoteCF-causing - Trans
CF 1094heterozygoteCF-causing- Undef
CF 655heterozygoteCF-causing- Undef
CF 4723heterozygoteCF-causing- Undef
CF 230heterozygoteCF-causing- Undef
CF 267heterozygoteCF-causing- Undef
CF 316heterozygotevarying clinical consequence- Undef
CF 2179heterozygoteCF-causing- Undef
CF 2469heterozygoteCF-causing- Undef
CF 2610heterozygoteCF-causing- Undef
CF 2635heterozygotelikely CFTR-RD- Undef
CF 2694heterozygoteCF-causing- Undef
CF 2719heterozygoteCF-causing - Trans
CF 2111heterozygoteCF-causing- Undef
CF 2099heterozygoteCF-causing- Undef
CF 5510heterozygoteCFTR-RD-causing - Trans
CF 5511heterozygoteCFTR-RD-causing - Trans
CF 1740heterozygoteCF-causing- Undef
CF 1838heterozygoteCF-causing- Undef
CF 1976heterozygoteCF-causing- Undef
CF 2001heterozygoteCF-causing- Undef
CF 62heterozygoteCF-causing - Trans
Other 3233heterozygoteCFTR-RD-causing - Trans
Other 3141heterozygoteCFTR-RD-causing - Trans
Other 2834heterozygoteCFTR-RD-causing - Trans
Other 5201heterozygoteCFTR-RD-causing- Undef
Other 1123heterozygoteCFTR-RD-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
Fetal bowel anomalies 3186heterozygoteCF-causing - Trans
Fetal bowel anomalies 4709heterozygoteCF-causing - Trans
CRS-NP 4841heterozygotevarying clinical consequence- Undef
CBAVD 4552heterozygote
CBAVD 5945heterozygoteCFTR-RD-causing- Undef
CBAVD 4794heterozygoteCFTR-RD-causing- Undef
CBAVD 4795heterozygoteCFTR-RD-causing- Undef
CBAVD 401heterozygote
CBAVD 1434heterozygoteCFTR-RD-causing- Undef
CBAVD 1447heterozygoteCFTR-RD-causing- Undef
CBAVD 2742heterozygoteCFTR-RD-causing - Trans
CBAVD 1507heterozygoteCFTR-RD-causing- Undef
CBAVD 1875heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 3042heterozygotevarying clinical consequence - Trans
Pending (NBS) 5570heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 516heterozygotevarying clinical consequence - Trans
Pancreatitis 2586heterozygotevarying clinical consequence- Undef
Bronchiectasis 3213heterozygoteCFTR-RD-causing - Cis
varying clinical consequence - Trans
Asymptomatic compound heterozygote 4626heterozygoteVUS3 - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare