Variant NM_000492.4:c.1727G>C
Name | NM_000492.4:c.1727G>C | ||||
Protein name | NP_000483.3:p.(Gly576Ala) | ||||
Genomic name (hg19) | chr7:g.117230454G>C UCSC | ||||
#Exon/intron | exon 13 | ||||
Legacy Name | G576A | ||||
Class | non disease-causing | ||||
Subclass | NULL | ||||
complex allele in 69.70% of patients associated with WT sequence |
TTGTATTTATTAGACTCTCCTTTTG G ATACCTAGATGTTTTAACAGAAAAA |
Mutant sequence |
TTGTATTTATTAGACTCTCCTTTTG C ATACCTAGATGTTTTAACAGAAAAA |
|
R668C | non disease-causing |
D443Y | likely benign |
G576A ; R668C | non disease-causing |
D443Y ; G576A ; R668C | disease-causing - CFTR-RD-causing |
dbSNP rs1800098 |
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | yes | no |
TEZ-IVA | yes | no | yes | no |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 132 |
---|---|
Asymptomatic compound heterozygote | 17 |
CF | 6 |
CFTR-RD | 99
|
Fetal bowel anomalies | 1 |
Pending | 5 |
Pending (NBS) | 3 |
Pending non-CF | 1 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CF | 4360 | heterozygote | CF-causing- Undef CF-causing- Undef |
CF | 4665 | heterozygote | VUS3- Undef |
CF | 5215 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
CF | 5053 | heterozygote | CF-causing- Undef VUS3- Undef |
CF | 1128 | heterozygote | CF-causing - Cis varying clinical consequence - Trans |
CF | 1559 | heterozygote | CF-causing- Undef CF-causing- Undef |
Other | 4627 | heterozygote | CFTR-RD-causing - Trans |
Other | 2433 | heterozygote | VUS3- Undef |
Other | 4458 | heterozygote | CF-causing - Trans |
Other | 4570 | heterozygote | VUS3 - Cis CF-causing - Trans |
Other | 4809 | heterozygote | VUS3 - Cis CF-causing- Undef |
Other | 4262 | heterozygote | CF-causing - Trans |
Other | 4278 | heterozygote | VUS3 - Cis CF-causing - Trans VUS1- Undef |
Other | 972 | heterozygote | CF-causing - Trans |
Other | 5264 | heterozygote | VUS3- Undef CF-causing- Undef |
Other | 5353 | heterozygote | CFTR-RD-causing- Undef |
Other | 4671 | heterozygote | VUS3- Undef |
Other | 5083 | heterozygote | VUS3- Undef CF-causing- Undef |
Other | 5814 | heterozygote | VUS3- Undef CF-causing- Undef |
Fetal bowel anomalies | 4672 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2989 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 3335 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 5590 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 5764 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4752 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4646 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 2853 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 2411 | heterozygote | |
CBAVD | 2485 | heterozygote | VUS3 - Cis CF-causing- Undef VUS3- Undef |
CBAVD | 2551 | heterozygote | CF-causing- Undef |
CBAVD | 2756 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 2806 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 2824 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 5610 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 4534 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 4571 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4574 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4612 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4331 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 5943 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 5947 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4279 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 549 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 556 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 658 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 659 | heterozygote | VUS3- Undef VUS3- Undef |
CBAVD | 682 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 763 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 900 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 511 | heterozygote | VUS3 - Cis VUS3 - Trans |
CBAVD | 508 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
CBAVD | 497 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4683 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4722 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 4735 | heterozygote | VUS3 - Cis varying clinical consequence - Trans |
CBAVD | 395 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 404 | heterozygote | VUS3 - Cis varying clinical consequence- Undef |
CBAVD | 430 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 433 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 452 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 480 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 5463 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 5665 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
CBAVD | 5882 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 6223 | heterozygote | VUS3 - Cis varying clinical consequence- Undef VUS3- Undef |
CBAVD | 2078 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CBAVD | 2141 | heterozygote | CF-causing- Undef |
CBAVD | 1833 | heterozygote | CF-causing- Undef |
CBAVD | 5181 | heterozygote | VUS3 - Cis CF-causing - Trans VUS3- Undef |
CBAVD | 1248 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1335 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1340 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1365 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1381 | heterozygote | VUS3 - Cis |
CBAVD | 1423 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1510 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1512 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1745 | heterozygote | VUS3 - Cis CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 2966 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 3257 | heterozygote | VUS3 - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 5601 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 2808 | heterozygote | varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 5602 | heterozygote | VUS3 - Cis VUS3 - Trans |
Asymptomatic compound heterozygote | 4358 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 4422 | heterozygote | VUS3 - Cis VUS3 - Trans |
Asymptomatic compound heterozygote | 4345 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 5964 | heterozygote | VUS3 - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 4260 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 4961 | heterozygote | CF-causing- Undef |
Asymptomatic compound heterozygote | 5141 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5073 | heterozygote | |
Asymptomatic compound heterozygote | 5081 | heterozygote | |
Asymptomatic compound heterozygote | 5705 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 2142 | heterozygote | CF-causing- Undef |
Asymptomatic compound heterozygote | 1290 | heterozygote | CFTR-RD-causing - Trans |
Pending non-CF | 4825 | heterozygote | VUS3 - Cis varying clinical consequence - Trans |
Bronchiectasis | 2243 | heterozygote | CF-causing- Undef |
Bronchiectasis | 2838 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 6192 | heterozygote | CF-causing- Undef |
Bronchiectasis | 4308 | heterozygote | |
Bronchiectasis | 5126 | heterozygote | VUS3- Undef |
Bronchiectasis | 1844 | heterozygote | CF-causing- Undef |
Bronchiectasis | 5669 | heterozygote | VUS3 - Cis VUS3 - Trans |
Bronchiectasis | 6282 | heterozygote | VUS3 - Cis CF-causing - Trans |
Bronchiectasis | 4974 | heterozygote | VUS3- Undef |
Pancreatitis | 2984 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 3072 | heterozygote | CF-causing - Trans |
Pancreatitis | 5340 | heterozygote | VUS3- Undef |
Pancreatitis | 2318 | heterozygote | |
Pancreatitis | 2338 | heterozygote | VUS3 - Cis |
Pancreatitis | 2748 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 6201 | heterozygote | |
Pancreatitis | 4240 | heterozygote | CF-causing - Trans VUS3 - Trans |
Pancreatitis | 4258 | heterozygote | |
Pancreatitis | 4301 | heterozygote | |
Pancreatitis | 5458 | heterozygote | VUS3- Undef |
Pancreatitis | 5740 | heterozygote | VUS3 - Cis |
Pancreatitis | 2065 | heterozygote | |
Pancreatitis | 4996 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1327G>T - p.(Asp443Tyr) - Trans |
Aquagenic palmoplantar keratoderma | 6276 | heterozygote | CF-causing - Trans |
Aquagenic palmoplantar keratoderma | 4660 | heterozygote | varying clinical consequence - Trans |
Aquagenic palmoplantar keratoderma | 5086 | heterozygote | likely CFTR-RD- Undef |
Pending | 2360 | heterozygote | |
Pending | 2843 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending | 3236 | heterozygote | CF-causing - Trans |
Pending | 4304 | heterozygote | VUS3 - Cis |
Pending | 4505 | heterozygote | CF-causing - Trans |
CRS-NP | 3043 | heterozygote | VUS3 - Cis CF-causing - Trans |
CRS-NP | 4805 | heterozygote | |
Pending (NBS) | 4420 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4806 | heterozygote | |
Pending (NBS) | 6010 | heterozygote | CF-causing- Undef |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|