Updates for c.1865G>A:
2024-08-01 subclass updated from VCC to CFTR-RD-causing




Variant NM_000492.4:c.1865G>A


Variant details:
Name NM_000492.4:c.1865G>A
Protein name NP_000483.3:p.(Gly622Asp)
Genomic name (hg19)     chr7:g.117232086G>A    UCSC    
Genomic name (hg38) chr7:g.117592032G>A    UCSC
#Exon/intron exon 14
Legacy Name G622D
Class disease-causing
Subclass CFTR-RD-causing
WT sequence GACAAAATATTAATTTTGCATGAAG G TAGCAGCTATTTTTATGGGACATTT
Mutant sequence GACAAAATATTAATTTTGCATGAAG A TAGCAGCTATTTTTATGGGACATTT

Other databases:
dbSNP
rs121908759



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Vankeerberghen et al, 1998 9736778
Billet et al, 2010 20435887


« ✓ » indicates the type of analysis performed and not the results



Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVAnononono
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


No patient found in CFTR-NGS catalogue


27 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 27
Asymptomatic compound heterozygote 1
CF 4
CFTR-RD18
  • CBAVD  13
  • Other  3
  • Pancreatitis  2
Fetal bowel anomalies 3
Pending 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Fetal bowel anomalies 4672heterozygote
Fetal bowel anomalies 2397heterozygoteVUS3 - Cis
CFTR-RD-causing - Trans
Fetal bowel anomalies 2588heterozygoteVUS3- Undef
Other 6357heterozygotevarying clinical consequence - Trans
Other 1113heterozygoteCF-causing- Undef
VUS3- Undef
Other 5675homozygotec.1865G>A - p.(Gly622Asp) - Trans
CBAVD 2504heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 2594heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 2709heterozygoteCF-causing- Undef
CBAVD 2365heterozygoteCFTR-RD-causing- Undef
CBAVD 2261heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 2221heterozygoteCF-causing- Undef
CBAVD 1301heterozygoteCF-causing- Undef
CBAVD 1384heterozygoteCFTR-RD-causing- Undef
CBAVD 1489heterozygoteCF-causing- Undef
CBAVD 1957heterozygoteCF-causing- Undef
CBAVD 2071heterozygoteCF-causing - Trans
CBAVD 2150heterozygotevarying clinical consequence- Undef
CBAVD 6300heterozygoteVUS3- Undef
Pancreatitis 4976heterozygotevarying clinical consequence- Undef
Pancreatitis 5698heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 2396heterozygoteVUS3 - Cis
CF 2618heterozygoteCF-causing- Undef
CF 2619heterozygoteCF-causing- Undef
CF 2657heterozygoteCF-causing- Undef
CF 5711heterozygoteCF-causing - Trans
Pending 4229heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare