2024-08-01 | subclass updated from VCC to CFTR-RD-causing |
Variant NM_000492.4:c.1865G>A
Name | NM_000492.4:c.1865G>A |
Protein name | NP_000483.3:p.(Gly622Asp) |
Genomic name (hg19) | chr7:g.117232086G>A UCSC |
Genomic name (hg38) | chr7:g.117592032G>A UCSC |
#Exon/intron | exon 14 |
Legacy Name | G622D |
Class | disease-causing |
Subclass | CFTR-RD-causing |
WT sequence | GACAAAATATTAATTTTGCATGAAG G TAGCAGCTATTTTTATGGGACATTT |
Mutant sequence | GACAAAATATTAATTTTGCATGAAG A TAGCAGCTATTTTTATGGGACATTT |
![]() |
![]() | dbSNP rs121908759 |
![]() | ![]() |
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | no | no | no | no |
TEZ-IVA | yes | no | yes | no |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 27 |
---|---|
Asymptomatic compound heterozygote | 1 |
CF | 4 |
CFTR-RD | 18
|
Fetal bowel anomalies | 3 |
Pending | 1 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
Fetal bowel anomalies | 4672 | heterozygote | CFTR-RD-causing - Cis |
Fetal bowel anomalies | 2397 | heterozygote | CFTR-RD-causing - Cis VUS1 - Cis CFTR-RD-causing - Trans |
Fetal bowel anomalies | 2588 | heterozygote | CFTR-RD-causing - Cis VUS3- Undef |
Other | 6357 | heterozygote | CFTR-RD-causing - Cis varying clinical consequence - Trans |
Other | 1113 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS1- Undef |
Other | 5675 | homozygote | c.1865G>A - p.(Gly622Asp) - Trans |
CBAVD | 2504 | heterozygote | CFTR-RD-causing - Cis CF-causing- Undef VUS1- Undef |
CBAVD | 2594 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS1- Undef |
CBAVD | 2709 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2365 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2261 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS1- Undef |
CBAVD | 2221 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1301 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1384 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1489 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1957 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CBAVD | 2071 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
CBAVD | 2150 | heterozygote | varying clinical consequence- Undef CFTR-RD-causing- Undef |
CBAVD | 6300 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Pancreatitis | 4976 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Pancreatitis | 5698 | heterozygote | CFTR-RD-causing - Cis varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 2396 | heterozygote | CFTR-RD-causing - Cis VUS1 - Cis |
CF | 2618 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CF | 2619 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CF | 2657 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CF | 5711 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
Pending | 4229 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|