Variant NM_000492.4:c.2051_2052delinsG


Variant details:
Name NM_000492.4:c.2051_2052delinsG
Protein name NP_000483.3:p.(Lys684Serfs*38)
Genomic name (hg19) chr7:g.117232272_117232273delinsG    UCSC    
#Exon/intron exon 14
Legacy Name 2183AA>G
Class disease-causing
Subclass CF-causing
WT sequence CCTGTCTCCTGGACAGAAACAAAAA AA CAATCTTTTAAACAGACTGGAGAGT
Mutant sequence CCTGTCTCCTGGACAGAAACAAAAA G- CAATCTTTTAAACAGACTGGAGAGT

Other databases:
dbSNP
rs121908799







Pathogenicity predictors:

Not found





No patient found in CFTR-NGS catalogue


54 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 54
Asymptomatic compound heterozygote 1
CF 38
CFTR-RD12
  • Bronchiectasis  2
  • CBAVD  6
  • Other  4
Pending 1
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Other 6178heterozygote
Other 3167heterozygoteCFTR-RD-causing - Trans
Other 4711heterozygoteCFTR-RD-causing- Undef
Other 1073heterozygotevarying clinical consequence- Undef
CF 4471heterozygoteCF-causing - Trans
CF 3097heterozygotevarying clinical consequence- Undef
CF 2955heterozygoteCF-causing - Trans
CF 2546heterozygote
CF 2508heterozygoteCF-causing- Undef
CF 2467heterozygoteCF-causing- Undef
CF 2374heterozygotevarying clinical consequence- Undef
CF 2056heterozygoteCF-causing- Undef
CF 2044heterozygotevarying clinical consequence- Undef
CF 1987heterozygoteCF-causing- Undef
CF 1885heterozygoteCF-causing- Undef
CF 3104heterozygotevarying clinical consequence- Undef
CF 3131heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 3132heterozygoteCF-causing - Trans
CF 4470heterozygoteCF-causing - Trans
CF 4058heterozygoteCF-causing- Undef
CF 4012heterozygoteCF-causing- Undef
CF 3808heterozygoteCF-causing - Trans
CF 1859heterozygoteCF-causing- Undef
CF 1812heterozygotevarying clinical consequence- Undef
CF 1805heterozygotevarying clinical consequence- Undef
CF 747heterozygoteCF-causing - Trans
CF 680heterozygotelikely CF - Trans
CF 379heterozygoteCF-causing - Trans
CF 355heterozygoteCF-causing - Trans
CF 298heterozygoteCF-causing - Trans
CF 210heterozygoteCF-causing- Undef
CF 196heterozygoteCF-causing- Undef
CF 4962heterozygoteCFTR-RD-causing - Trans
CF 4786heterozygoteCF-causing- Undef
CF 1764heterozygotevarying clinical consequence- Undef
CF 1535heterozygoteCF-causing - Trans
CFTR-RD-causing - Trans
CF 1254heterozygoteCF-causing- Undef
CF 1236heterozygoteCF-causing - Trans
CF 213homozygotec.2051_2052delinsG - p.(Lys684Serfs*38) - Trans
CF 4115homozygotec.2051_2052delinsG - p.(Lys684Serfs*38) - Trans
CF 1937homozygotec.2051_2052delinsG - p.(Lys684Serfs*38) - Trans
CF 4042homozygotec.2051_2052delinsG - p.(Lys684Serfs*38) - Trans
CBAVD 3734heterozygoteCF-causing- Undef
CBAVD 433heterozygoteVUS3- Undef
CBAVD 429heterozygoteCFTR-RD-causing - Trans
CBAVD 395heterozygoteVUS3 - Trans
CBAVD 1392heterozygoteCFTR-RD-causing- Undef
CBAVD 1364heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 4857heterozygoteCF-causing - Trans
Bronchiectasis 1118heterozygoteCF-causing - Trans
Pending 1155heterozygoteVUS3 - Trans
Pending (NBS) 4113heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 4655heterozygote
Asymptomatic compound heterozygote 3794heterozygoteVUS3 - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare