2022-07-26 | Class updated from VUS to disease_causing, CFTR-RD-causing |
2024-10-14 | Class updated from CFTR-RD-causing to non disease-causing |
2024-12-09 | Variant classified as non-disease-causing on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data |
Variant NM_000492.4:c.220C>T
Name | NM_000492.4:c.220C>T | ||||
Protein name | NP_000483.3:p.(Arg74Trp) | ||||
Genomic name (hg19) | chr7:g.117149143C>T UCSC | ||||
Genomic name (hg38) | chr7:g.117509089C>T UCSC | ||||
#Exon/intron | exon 3 | ||||
Legacy Name | R74W | ||||
Class | non disease-causing | ||||
complex allele in 63.10% of patients associated with WT sequence |
AAATCCTAAACTCATTAATGCCCTT C GGCGATGTTTTTTCTGGAGATTTAT |
Mutant sequence |
AAATCCTAAACTCATTAATGCCCTT T GGCGATGTTTTTTCTGGAGATTTAT |
|
D1270N | non disease-causing |
V201M | likely benign |
R74W ; D1270N | non disease-causing |
R74W ; V201M ; D1270N | disease-causing - CFTR-RD-causing |
![]() |
![]() | dbSNP rs115545701 |
![]() | ![]() |
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | yes | no |
TEZ-IVA | yes | no | yes | no |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
2 individuals carrying this variant are reported in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 84 |
---|---|
Asymptomatic compound heterozygote | 9 |
CF | 4 |
CFTR-RD | 59
|
Pending | 5 |
Pending (NBS) | 7 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
Other | 4767 | heterozygote | CF-causing - Trans |
Other | 3076 | heterozygote | CF-causing - Trans |
Other | 6474 | heterozygote | CF-causing- Undef VUS3- Undef |
Other | 4702 | heterozygote | VUS3 - Cis CF-causing - Trans |
Other | 5075 | heterozygote | VUS3 - Cis CF-causing - Trans |
Other | 1124 | heterozygote | varying clinical consequence- Undef |
Other | 5383 | heterozygote | VUS3 - Cis CF-causing - Trans |
Other | 1283 | heterozygote | CF-causing- Undef |
Other | 3138 | homozygote | c.601G>A - p.(Val201Met) - Trans |
Pending | 3073 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending | 4337 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending | 4336 | heterozygote | CF-causing - Trans |
Pending | 4078 | heterozygote | CF-causing- Undef |
Pending | 4819 | heterozygote | CF-causing- Undef |
CBAVD | 5875 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 2347 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
CBAVD | 6222 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 3208 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 4556 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 6473 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
CBAVD | 4224 | heterozygote | VUS3 - Cis VUS2 - Trans |
CBAVD | 3324 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 5872 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
CBAVD | 5519 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 5223 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 892 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
CBAVD | 751 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 697 | heterozygote | VUS3 - Cis varying clinical consequence - Trans |
CBAVD | 565 | heterozygote | VUS3 - Cis VUS3- Undef VUS1- Undef |
CBAVD | 543 | heterozygote | VUS3 - Cis CF-causing - Trans |
CBAVD | 538 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans |
CBAVD | 503 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
CBAVD | 4956 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
CBAVD | 1269 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 5866 | heterozygote | CF-causing- Undef VUS3- Undef |
CBAVD | 1294 | heterozygote | VUS3 - Cis CFTR-RD-causing- Undef |
CBAVD | 1366 | heterozygote | VUS3 - Cis CF-causing- Undef |
CBAVD | 1412 | heterozygote | VUS3 - Cis varying clinical consequence- Undef |
CBAVD | 660 | homozygote | c.601G>A - p.(Val201Met) - Trans |
CBAVD | 1456 | homozygote | c.601G>A - p.(Val201Met) - Trans |
CBAVD | 507 | homozygote | c.601G>A - p.(Val201Met) - Trans |
Asymptomatic compound heterozygote | 2777 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 2214 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Asymptomatic compound heterozygote | 3156 | heterozygote | VUS3 - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 4517 | heterozygote | |
Asymptomatic compound heterozygote | 3794 | heterozygote | VUS3 - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 740 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 314 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 4989 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 782 | homozygote | c.601G>A - p.(Val201Met) - Trans |
CF | 5993 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
CF | 382 | heterozygote | VUS3 - Cis VUS3 - Cis CF-causing - Trans |
CF | 5285 | heterozygote | VUS3 - Cis CF-causing - Trans |
CF | 5059 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending (NBS) | 4593 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending (NBS) | 6090 | heterozygote | CF-causing- Undef VUS3- Undef |
Pending (NBS) | 5313 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending (NBS) | 5853 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending (NBS) | 991 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 5446 | heterozygote | VUS3 - Cis CF-causing - Trans |
Pending (NBS) | 5703 | heterozygote | VUS3 - Cis VUS3 - Cis CF-causing - Trans |
Bronchiectasis | 2455 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 5896 | heterozygote | VUS3- Undef |
Bronchiectasis | 5464 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 4984 | heterozygote | CF-causing- Undef |
Aquagenic palmoplantar keratoderma | 5470 | heterozygote | VUS3 - Cis CFTR-RD-causing- Undef |
Pancreatitis | 2538 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 4894 | heterozygote | |
Pancreatitis | 2302 | heterozygote | |
Pancreatitis | 6429 | heterozygote | VUS3 - Cis CFTR-RD-causing- Undef |
Pancreatitis | 2033 | heterozygote | CF-causing- Undef |
Pancreatitis | 2137 | heterozygote | VUS3 - Cis CF-causing- Undef |
Pancreatitis | 2242 | heterozygote | VUS3 - Cis CFTR-RD-causing- Undef |
Pancreatitis | 2327 | heterozygote | |
Pancreatitis | 3232 | heterozygote | VUS1- Undef |
Pancreatitis | 3315 | heterozygote | VUS2 - Trans |
Pancreatitis | 5620 | heterozygote | VUS3 - Cis |
Pancreatitis | 5621 | heterozygote | |
Pancreatitis | 5623 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
Pancreatitis | 5869 | heterozygote | VUS3- Undef |
Pancreatitis | 1821 | heterozygote | VUS3 - Cis |
Pancreatitis | 5396 | heterozygote | VUS3 - Cis CF-causing - Trans |
CRS-NP | 3143 | heterozygote | VUS3 - Cis CF-causing - Trans |
CRS-NP | 5994 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|