Variant NM_000492.4:c.224G>A


Variant details:
Name NM_000492.4:c.224G>A
Protein name NP_000483.3:p.(Arg75Gln)
Genomic name (hg19)     chr7:g.117149147G>A    UCSC    
Genomic name (hg38) chr7:g.117509093G>A    UCSC
#Exon/intron exon 3
Legacy Name R75Q
Class non disease-causing
WT sequence CCTAAACTCATTAATGCCCTTCGGC G ATGTTTTTTCTGGAGATTTATGTTC
Mutant sequence CCTAAACTCATTAATGCCCTTCGGC A ATGTTTTTTCTGGAGATTTATGTTC

Other databases:
dbSNP
rs1800076



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Gene et al, 2008 18306312
Sosnay et al, 2013 23974870
LaRusch et al, 2014 25033378
Bergougnoux et al, 2015 25797027


« ✓ » indicates the type of analysis performed and not the results




2 individuals carrying this variant are reported in CFTR-NGS catalogue


39 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 39
Asymptomatic compound heterozygote 4
CF 4
CFTR-RD30
  • Bronchiectasis  6
  • CBAVD  9
  • Other  3
  • Pancreatitis  12
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Other 4714heterozygoteCF-causing- Undef
Other 3046heterozygotelikely CFTR-RD- Undef
Other 5163heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 4896heterozygoteCFTR-RD-causing- Undef
CBAVD 2949heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 3276heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
CBAVD 406heterozygote
CBAVD 473heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 781heterozygoteCFTR-RD-causing - Trans
CBAVD 823heterozygote
CBAVD 1243heterozygoteVUS2 - Cis
likely CFTR-RD - Trans
VUS3 - Trans
CBAVD 2037heterozygoteCF-causing- Undef
Pending (NBS) 775heterozygoteCF-causing- Undef
Bronchiectasis 2574heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 3038heterozygoteCFTR-RD-causing - Cis
Bronchiectasis 2291heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 899heterozygoteCF-causing- Undef
Bronchiectasis 2140heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 5664heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 922heterozygote
Asymptomatic compound heterozygote 5139heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5815heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5848heterozygote
CF 2363heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4307heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4431heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1300heterozygoteCF-causing- Undef
Pancreatitis 2313heterozygote
Pancreatitis 2322heterozygote
Pancreatitis 2364heterozygote
Pancreatitis 2403heterozygote
Pancreatitis 2408heterozygote
Pancreatitis 2584heterozygote
Pancreatitis 4275heterozygote
Pancreatitis 2311heterozygote
Pancreatitis 2300heterozygote
Pancreatitis 2100heterozygote
Pancreatitis 2156heterozygotevarying clinical consequence- Undef
Pancreatitis 2193heterozygote


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare