| 2024-10-14 | Class updated from CFTR-RD-causing to non disease-causing |
| 2024-12-09 | Variant classified as non-disease-causing on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data |
Variant NM_000492.4:c.2421A>G
| Name | NM_000492.4:c.2421A>G | ||||
| Protein name | NP_000483.3:p.(Ile807Met) | ||||
| Genomic name (hg19) | chr7:g.117232642A>G UCSC | ||||
| Genomic name (hg38) | chr7:g.117592588A>G UCSC | ||||
| #Exon/intron | exon 14 | ||||
| Legacy Name | I807M ; 2553A/G | ||||
| Class | non disease-causing | ||||
complex allele in 22.22% of patients associated with | WT sequence |
AGGCAAACTTGACTGAACTGGATAT A TATTCAAGAAGGTTATCTCAAGAAA |
Mutant sequence |
AGGCAAACTTGACTGAACTGGATAT G TATTCAAGAAGGTTATCTCAAGAAA |
|
![]() |
![]() | dbSNP rs1800103 |
![]() | ![]() |
| Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
| Vankeerberghen et al, 1998 | 9736778 | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
| Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
| IVA | yes | no | yes | no |
| TEZ-IVA | yes | no | yes | no |
| ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data presented above are provided by Vertex
No patient found in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 9 |
|---|---|
| Asymptomatic compound heterozygote | 2 |
| CFTR-RD | 7
|
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CBAVD | 927 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
| CBAVD | 4247 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4248 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 932 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
| Asymptomatic compound heterozygote | 5133 | heterozygote | VUS3- Undef |
| Pancreatitis | 1632 | heterozygote | CF-causing- Undef |
| Pancreatitis | 2185 | heterozygote | |
| Pancreatitis | 2252 | heterozygote | CF-causing- Undef |
| Other | 4587 | heterozygote |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|