Variant NM_000492.4:c.254G>A


Variant details:
Name NM_000492.4:c.254G>A
Protein name NP_000483.3:p.(Gly85Glu)
Genomic name (hg19)     chr7:g.117149177G>A    UCSC    
Genomic name (hg38) chr7:g.117509123G>A    UCSC
#Exon/intron exon 3
Legacy Name G85E
Class disease-causing
Subclass CF-causing
WT sequence TTTTTCTGGAGATTTATGTTCTATG G AATCTTTTTATATTTAGGGGTAAGG
Mutant sequence TTTTTCTGGAGATTTATGTTCTATG A AATCTTTTTATATTTAGGGGTAAGG

Other databases:
dbSNP
rs75961395



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Gene et al, 2008 18306312
Van Goor et al, 2014 23891399
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results



Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVAnononono
TEZ-IVAnononono
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnono yes

clinical and functional data presented above are provided by Vertex



Reference PMID Modulator in vitro / ex vivo data clinical data Patient responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yes yes



1 individuals carrying this variant are reported in CFTR-NGS catalogue


40 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 40
CF 31
CFTR-RD7
  • Bronchiectasis  1
  • CBAVD  3
  • CRS-NP  2
  • Pancreatitis  1
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 17heterozygoteCF-causing - Trans
CF 4967heterozygoteCF-causing - Trans
CF 2986heterozygoteCF-causing - Trans
CF 2985heterozygoteCF-causing - Trans
CF 2799heterozygoteCF-causing- Undef
CF 2475heterozygoteCF-causing- Undef
CF 2220heterozygoteCF-causing- Undef
CF 2154heterozygoteCF-causing- Undef
CF 3649heterozygoteCF-causing- Undef
CF 4379heterozygoteCF-causing - Trans
CF 4341heterozygoteCF-causing - Trans
VUS3 - Trans
CF 4340heterozygotevarying clinical consequence - Trans
CF 4339heterozygotevarying clinical consequence - Trans
CF 4332heterozygotevarying clinical consequence - Trans
CF 3960heterozygoteCF-causing- Undef
CF 3826heterozygoteCF-causing- Undef
CF 1959heterozygoteCF-causing- Undef
CF 1927heterozygoteCF-causing- Undef
CF 267heterozygoteCF-causing- Undef
CF 307heterozygoteCF-causing - Trans
CF 310heterozygoteCF-causing - Trans
CF 5515heterozygoteVUS3 - Trans
CF 5516heterozygoteVUS3 - Trans
CF 1036heterozygoteCF-causing - Trans
CF 1172heterozygoteCF-causing - Trans
CF 5389heterozygoteCF-causing- Undef
CF 1779heterozygoteCF-causing- Undef
CF 6516heterozygotevarying clinical consequence- Undef
CF 4867heterozygoteCFTR-RD-causing- Undef
CF 1206heterozygoteCF-causing - Trans
CF 172homozygotec.254G>A - p.(Gly85Glu) - Trans
Pending (NBS) 4693heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 6011heterozygotevarying clinical consequence- Undef
CRS-NP 4384heterozygotevarying clinical consequence - Trans
CRS-NP 295heterozygoteCFTR-RD-causing - Trans
Pancreatitis 648heterozygoteCFTR-RD-causing - Trans
CBAVD 2425heterozygoteCFTR-RD-causing- Undef
CBAVD 3734heterozygoteCF-causing- Undef
CBAVD 1759heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 5112heterozygotevarying clinical consequence- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare