Updates for c.2619+106T>A:
2024-10-14 Class updated from VUS3 to non disease-causing




Variant NM_000492.4:c.2619+106T>A


Variant details:
Name NM_000492.4:c.2619+106T>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117235218T>A    UCSC    
Genomic name (hg38) chr7:g.117595164T>A    UCSC
#Exon/intron intron 15
Class non disease-causing
WT sequence ACACATAAATATGTATATATACACA T GTATACATGTATAAGTATGCATATA
Mutant sequence ACACATAAATATGTATATATACACA A GTATACATGTATAAGTATGCATATA

Other databases:

Not found
Not found		dbSNP
rs4148713







Pathogenicity predictors:

Not found




11 individuals carrying this variant are reported in CFTR-NGS catalogue


22 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 22
Asymptomatic compound heterozygote 3
CF 3
CFTR-RD14
  • CBAVD  6
  • Other  3
  • Pancreatitis  5
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Other 4698heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 5243heterozygoteVUS3- Undef
Other 4625heterozygoteVUS3- Undef
CF 5341heterozygoteVUS3- Undef
CF-causing- Undef
CF 6441heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5067heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5765heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5766heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
CBAVD 5945heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4663heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5068heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5325homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.769G>T - p.(Glu257*) - Trans
Pending (NBS) 4620heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4645heterozygoteCF-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 6440heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 4656heterozygoteVUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5164heterozygoteCF-causing- Undef
Pancreatitis 5332heterozygote
Pancreatitis 5339heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 5364heterozygoteVUS3- Undef
Pancreatitis 5949heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 5154heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare