Updates for c.262_263del:
2023-02-02 name changed from c.262_263delTT to c.262_263del




Variant NM_000492.4:c.262_263del


Variant details:
Name NM_000492.4:c.262_263del
Protein name NP_000483.3:p.(Leu88Ilefs*22)
Genomic name (hg19)     chr7:g.117149185_117149186del    UCSC    
Genomic name (hg38) chr7:g.117509131_117509132del    UCSC
#Exon/intron exon 3
Legacy Name 394delTT
Class disease-causing
Subclass CF-causing
WT sequence GAGATTTATGTTCTATGGAATCTTT TT ATATTTAGGGGTAAGGATCTCATTT
Mutant sequence GAGATTTATGTTCTATGGAATCTTT -- ATATTTAGGGGTAAGGATCTCATTT

Other databases:
dbSNP
rs121908769







Pathogenicity predictors:

Not found





Reference PMID Modulator in vitro / ex vivo data Clinical data Variant responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yesno

variant non responsiveness based on clinical data, sweat chloride concentration, ppFEV1, chest CT imaging before and after ETI treatment (n>3 for 6-8 weeks)


No patient found in CFTR-NGS catalogue


37 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 37
CF 26
CFTR-RD8
  • CBAVD  7
  • Other  1
Fetal bowel anomalies 1
Pending 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending 4701heterozygoteVUS3 - Trans
Pending 5588heterozygoteCFTR-RD-causing - Trans
CF 2899heterozygoteCF-causing - Trans
CF 3086heterozygoteCF-causing- Undef
CF 3127heterozygoteCF-causing - Trans
CF 3134heterozygoteCF-causing - Trans
CF 3177heterozygoteCF-causing - Trans
CF 3242heterozygoteCF-causing - Trans
CF 3262heterozygoteCF-causing - Trans
CF 3347heterozygoteCF-causing - Trans
CF 3647heterozygoteCF-causing - Trans
CF 4018heterozygoteCF-causing- Undef
CF 4107heterozygoteCF-causing- Undef
CF 2896heterozygoteCF-causing - Trans
CF 2880heterozygotevarying clinical consequence- Undef
CF 2864heterozygoteCF-causing - Trans
CF 351heterozygotevarying clinical consequence - Trans
CF 360heterozygoteCF-causing - Trans
CF 1728heterozygotevarying clinical consequence- Undef
CF 1729heterozygotevarying clinical consequence- Undef
CF 1744heterozygoteCF-causing- Undef
CF 2688heterozygoteCF-causing - Trans
CF 2722heterozygoteCF-causing - Trans
CF 2755heterozygoteCF-causing - Trans
CF 2767heterozygoteCF-causing - Trans
CF 2795heterozygoteCF-causing - Trans
CF 2836heterozygoteCF-causing - Trans
CF 4277heterozygoteCF-causing- Undef
CBAVD 4663heterozygotevarying clinical consequence- Undef
CBAVD 3341heterozygoteCFTR-RD-causing- Undef
CBAVD 3355heterozygoteCFTR-RD-causing- Undef
CBAVD 897heterozygotevarying clinical consequence- Undef
CBAVD 1487heterozygoteCFTR-RD-causing- Undef
CBAVD 2720heterozygoteCFTR-RD-causing- Undef
CBAVD 2728heterozygoteCFTR-RD-causing - Trans
Other 5264heterozygoteVUS3- Undef
Fetal bowel anomalies 3402heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare