Updates for c.2900T>C:
2024-10-14 Class updated from VUS2 to non disease-causing
2024-12-09 Variant classified as non-disease-causing on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data




Variant NM_000492.4:c.2900T>C


Variant details:
Name NM_000492.4:c.2900T>C
Protein name NP_000483.3:p.(Leu967Ser)
Genomic name (hg19)     chr7:g.117243828T>C    UCSC    
Genomic name (hg38) chr7:g.117603774T>C    UCSC
#Exon/intron exon 17
Legacy Name L967S
Class non disease-causing
WT sequence GCACCTATGTCAACCCTCAACACGT T GAAAGCAGGTACTTTACTAGGTCTA
Mutant sequence GCACCTATGTCAACCCTCAACACGT C GAAAGCAGGTACTTTACTAGGTCTA

Other databases:
dbSNP
rs1800110



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
LaRusch et al, 2014 25033378 ✓ ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnoyesno
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


No patient found in CFTR-NGS catalogue


21 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 21
Asymptomatic compound heterozygote 3
CF 3
CFTR-RD6
  • Bronchiectasis  2
  • Other  1
  • Pancreatitis  3
Fetal bowel anomalies 1
Pending (NBS) 8




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 896heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4900heterozygoteCF-causing- Undef
CF 2716heterozygote
Fetal bowel anomalies 1565heterozygoteCF-causing - Cis
CF-causing - Trans
Pancreatitis 3224heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5779heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5877heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 4656heterozygoteVUS3 - Trans
VUS3- Undef
Asymptomatic compound heterozygote 5308heterozygote
Asymptomatic compound heterozygote 5695heterozygoteCF-causing- Undef
Pending (NBS) 4249heterozygoteCF-causing - Trans
Pending (NBS) 4549heterozygoteCF-causing - Trans
VUS3 - Trans
Pending (NBS) 4573heterozygoteCF-causing - Trans
Pending (NBS) 6089heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 4655heterozygoteCF-causing - Trans
Pending (NBS) 2877heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 2940heterozygoteCF-causing - Trans
Pending (NBS) 6017heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 6200heterozygoteCF-causing- Undef
Bronchiectasis 3269heterozygoteCF-causing- Undef
Other 6178heterozygoteCF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare