Variant NM_000492.4:c.2930C>T
Name | NM_000492.4:c.2930C>T | ||||
Protein name | NP_000483.3:p.(Ser977Phe) | ||||
Genomic name (hg19) | chr7:g.117246749C>T UCSC | ||||
#Exon/intron | exon 18 | ||||
Legacy Name | S977F | ||||
Class | disease-causing | ||||
Subclass | varying clinical consequence | ||||
complex allele in 30.00% of patients associated with WT sequence |
ATAGGTGGGATTCTTAATAGATTCT C CAAAGATATAGCAATTTTGGATGAC |
Mutant sequence |
ATAGGTGGGATTCTTAATAGATTCT T CAAAGATATAGCAATTTTGGATGAC |
|
dbSNP rs141033578 |
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | no | yes |
TEZ-IVA | yes | yes | no | yes |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 20 |
---|---|
Asymptomatic compound heterozygote | 1 |
CF | 5 |
CFTR-RD | 11
|
Pending | 1 |
Pending (NBS) | 2 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CBAVD | 653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 5022 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans VUS3- Undef |
CBAVD | 3394 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
CBAVD | 2800 | heterozygote | CFTR-RD-causing - Cis varying clinical consequence - Trans |
CBAVD | 2460 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CBAVD | 1453 | heterozygote | CFTR-RD-causing - Trans non-CF - Trans |
Other | 980 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
CF | 4171 | heterozygote | CF-causing - Trans |
CF | 6203 | heterozygote | CF-causing- Undef |
CF | 4831 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CF | 1519 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
CF | 1537 | homozygote | c.1210-34_1210-6TG[12]T[5] - Trans c.2930C>T - p.(Ser977Phe) - Trans |
Pancreatitis | 5326 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
Pancreatitis | 1725 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 6183 | heterozygote | CFTR-RD-causing - Cis CF-causing - Trans |
Bronchiectasis | 5028 | homozygote | c.1210-34_1210-6TG[12]T[5] - Trans c.2930C>T - p.(Ser977Phe) - Trans |
Pending (NBS) | 4745 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Pending (NBS) | 5037 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Asymptomatic compound heterozygote | 3012 | heterozygote | CFTR-RD-causing - Cis VUS1 - Trans |
Pending | 4746 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|