Updates for c.2991G>C:
2024-12-09 Variant classified as CFTR-RD-causing (low penetrance) on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data




Variant NM_000492.4:c.2991G>C


Variant details:
Name NM_000492.4:c.2991G>C
Protein name NP_000483.3:p.(Leu997Phe)
Genomic name (hg19)     chr7:g.117250575G>C    UCSC    
Genomic name (hg38) chr7:g.117610521G>C    UCSC
#Exon/intron exon 19
Legacy Name L997F
Class disease-causing
Subclass CFTR-RD-causing
WT sequence ACATGTTTTCTTTGATCTTACAGTT G TTATTAATTGTGATTGGAGCTATAG
Mutant sequence ACATGTTTTCTTTGATCTTACAGTT C TTATTAATTGTGATTGGAGCTATAG

Other databases:
dbSNP
rs1800111



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓
LaRusch et al, 2014 25033378 ✓ ✓ ✓
Bergougnoux et al, 2015 25797027 ✓ ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnoyesno
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


4 individuals carrying this variant are reported in CFTR-NGS catalogue


126 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 126
Asymptomatic compound heterozygote 11
CF 4
CFTR-RD98
  • Aquagenic palmoplantar keratoderma  4
  • Bronchiectasis  9
  • CBAVD  36
  • CRS-NP  3
  • Other  7
  • Pancreatitis  39
Fetal bowel anomalies 1
Pending 2
Pending (NBS) 10




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pancreatitis 5453heterozygoteCF-causing- Undef
Pancreatitis 2346heterozygoteCF-causing- Undef
Pancreatitis 2483heterozygote
Pancreatitis 2486heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pancreatitis 4918heterozygoteVUS3- Undef
Pancreatitis 2748heterozygote
Pancreatitis 2785heterozygote
Pancreatitis 2786heterozygoteCF-causing - Trans
Pancreatitis 2285heterozygote
Pancreatitis 2242heterozygoteVUS3- Undef
Pancreatitis 5454heterozygoteCF-causing- Undef
Pancreatitis 5455heterozygoteCF-causing- Undef
Pancreatitis 5668heterozygoteCF-causing- Undef
Pancreatitis 5700heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5870heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pancreatitis 5879heterozygote
Pancreatitis 5894heterozygote
Pancreatitis 6429heterozygoteVUS3- Undef
Pancreatitis 6550heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 2198heterozygoteCFTR-RD-causing- Undef
Pancreatitis 3182heterozygoteCF-causing- Undef
Pancreatitis 4318heterozygoteCFTR-RD-causing- Undef
Pancreatitis 6541heterozygotelikely CFTR-RD- Undef
Pancreatitis 5623heterozygoteVUS3 - Trans
Pancreatitis 3312heterozygote
Pancreatitis 5010heterozygoteCFTR-RD-causing- Undef
Pancreatitis 76heterozygoteCF-causing - Trans
Pancreatitis 964heterozygote
Pancreatitis 1650heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4977heterozygoteCF-causing- Undef
Pancreatitis 1836heterozygoteCF-causing- Undef
Pancreatitis 5102heterozygote
Pancreatitis 5368heterozygotevarying clinical consequence- Undef
Pancreatitis 5388heterozygote
Pancreatitis 5145heterozygoteCF-causing- Undef
Pancreatitis 6204homozygotec.2991G>C - p.(Leu997Phe) - Trans
Pancreatitis 5862homozygotec.2991G>C - p.(Leu997Phe) - Trans
Pancreatitis 4926homozygotec.2991G>C - p.(Leu997Phe) - Trans
Pancreatitis 5125homozygotec.2991G>C - p.(Leu997Phe) - Trans
Pending (NBS) 2038heterozygoteCF-causing- Undef
Pending (NBS) 6003heterozygoteCF-causing- Undef
Pending (NBS) 6084heterozygoteCF-causing- Undef
Pending (NBS) 6089heterozygote
Pending (NBS) 4666heterozygoteCF-causing - Trans
Pending (NBS) 6017heterozygote
Pending (NBS) 4693heterozygoteCF-causing - Trans
Pending (NBS) 4667heterozygoteCF-causing - Trans
Pending (NBS) 352heterozygoteCF-causing - Trans
Pending (NBS) 5183heterozygoteCF-causing - Trans
VUS3- Undef
Bronchiectasis 2367heterozygote
Bronchiectasis 4906heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 1985heterozygoteCF-causing- Undef
Bronchiectasis 3213heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Bronchiectasis 4613heterozygote
Bronchiectasis 560heterozygoteCF-causing- Undef
Bronchiectasis 4726heterozygotevarying clinical consequence- Undef
Bronchiectasis 4866heterozygoteCF-causing- Undef
Bronchiectasis 5153homozygotec.2991G>C - p.(Leu997Phe) - Trans
Other 2696heterozygotevarying clinical consequence- Undef
Other 4664heterozygoteCF-causing- Undef
Other 4582heterozygoteCF-causing- Undef
Other 6467heterozygoteCF-causing- Undef
Other 645heterozygoteCF-causing- Undef
Other 4842heterozygoteVUS3 - Trans
Other 5201heterozygoteCF-causing- Undef
CBAVD 4905heterozygoteCF-causing- Undef
CBAVD 4919heterozygoteCF-causing- Undef
CBAVD 2689heterozygoteCF-causing- Undef
CBAVD 5871heterozygoteCF-causing- Undef
CBAVD 4586heterozygote
CBAVD 4589heterozygote
CBAVD 6465heterozygoteCF-causing- Undef
CBAVD 3318heterozygoteCFTR-RD-causing - Trans
non-CF - Trans
CBAVD 3361heterozygoteCF-causing- Undef
CBAVD 3366heterozygoteCF-causing- Undef
CBAVD 3377heterozygoteCF-causing - Trans
CBAVD 6454heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CBAVD 525heterozygoteCF-causing - Trans
CBAVD 538heterozygoteCFTR-RD-causing - Trans
CBAVD 707heterozygote
CBAVD 736heterozygoteCF-causing- Undef
CBAVD 849heterozygoteCF-causing- Undef
CBAVD 513heterozygoteCF-causing - Trans
CBAVD 510heterozygote
CBAVD 428heterozygoteCF-causing - Trans
CBAVD 447heterozygoteCF-causing- Undef
CBAVD 461heterozygoteCF-causing- Undef
CBAVD 462heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 469heterozygoteCF-causing- Undef
CBAVD 482heterozygote
CBAVD 483heterozygoteCF-causing- Undef
CBAVD 489heterozygoteCFTR-RD-causing - Trans
CBAVD 981heterozygoteCFTR-RD-causing- Undef
CBAVD 5444heterozygoteCF-causing- Undef
CBAVD 1464heterozygoteCFTR-RD-causing - Trans
non-CF - Trans
CBAVD 1487heterozygoteCF-causing- Undef
CBAVD 1634heterozygoteCF-causing- Undef
CBAVD 1655heterozygoteCF-causing- Undef
CBAVD 1759heterozygoteCF-causing- Undef
CBAVD 5819heterozygoteCF-causing- Undef
CBAVD 1294heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 3235heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 4749heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 6452heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 558heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 575heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 740heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 965heterozygote
Asymptomatic compound heterozygote 5222heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 4960heterozygote
Asymptomatic compound heterozygote 5815heterozygote
Asymptomatic compound heterozygote 739homozygotec.2991G>C - p.(Leu997Phe) - Trans
Fetal bowel anomalies 828heterozygoteCF-causing - Trans
Aquagenic palmoplantar keratoderma 4827heterozygoteCF-causing- Undef
Aquagenic palmoplantar keratoderma 6348heterozygotevarying clinical consequence - Trans
Aquagenic palmoplantar keratoderma 5470heterozygoteVUS3- Undef
Aquagenic palmoplantar keratoderma 6480heterozygoteVUS3- Undef
CF 5993heterozygoteCF-causing - Trans
CF 5026heterozygoteCF-causing - Trans
CF 4790heterozygoteCF-causing- Undef
CF 4962heterozygoteCF-causing - Trans
Pending 1240heterozygote
Pending 4748heterozygoteCF-causing - Trans
CRS-NP 5778heterozygoteVUS3- Undef
CRS-NP 5338heterozygotenon-CF- Undef
CRS-NP 5994heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare