Updates for c.3080T>C:
2024-10-14 Class updated from VUS1 to Likely benign




Variant NM_000492.4:c.3080T>C


Variant details:
Name NM_000492.4:c.3080T>C
Protein name NP_000483.3:p.(Ile1027Thr)
Genomic name (hg19)     chr7:g.117250664T>C    UCSC    
Genomic name (hg38) chr7:g.117610610T>C    UCSC
#Exon/intron exon 19
Legacy Name I1027T
Class likely benign
complex allele in 35.42% of patients associated with
  • c.1521_1523del - p.(Phe508del) : 100.00%
    • WT sequence ACAGTGCCAGTGATAGTGGCTTTTA T TATGTTGAGAGCATATTTCCTCCAA
    Mutant sequence ACAGTGCCAGTGATAGTGGCTTTTA C TATGTTGAGAGCATATTTCCTCCAA

    Other databases:
    dbSNP
    rs1800112



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Sosnay et al, 2013 23974870 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnoyesno
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno

    clinical and functional data presented above are provided by Vertex


    1 individuals carrying this variant are reported in CFTR-NGS catalogue


    48 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 48
    CF 24
    CFTR-RD22
    • Bronchiectasis  2
    • CBAVD  13
    • Other  3
    • Pancreatitis  4
    Pending 1
    Pending (NBS) 1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CBAVD 4598heterozygoteCF-causing- Undef
    VUS2- Undef
    CBAVD 2485heterozygoteVUS3- Undef
    CF-causing- Undef
    CBAVD 1969heterozygoteCF-causing- Undef
    varying clinical consequence- Undef
    CBAVD 1930heterozygoteCF-causing- Undef
    varying clinical consequence- Undef
    CBAVD 2693heterozygoteCF-causing - Cis
    CFTR-RD-causing- Undef
    CBAVD 5173heterozygoteCF-causing - Cis
    varying clinical consequence - Trans
    CBAVD 2949heterozygoteCF-causing - Cis
    CFTR-RD-causing - Trans
    CBAVD 451heterozygoteCF-causing - Cis
    likely CFTR-RD - Trans
    CBAVD 499heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 532heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 619heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    CBAVD 535heterozygoteCF-causing- Undef
    varying clinical consequence- Undef
    CBAVD 4682heterozygoteCF-causing- Undef
    CFTR-RD-causing- Undef
    CF 4893heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    VUS3- Undef
    CF 2262heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 2053heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 1863heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 4903heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    VUS3- Undef
    CF 4594heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 4482heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 2893heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 2889heterozygoteCF-causing- Undef
    VUS3- Undef
    CF 2750heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 4995heterozygoteCF-causing - Cis
    VUS3 - Cis
    VUS3 - Trans
    CF 466heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 359heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 304heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 245heterozygoteCF-causing - Cis
    VUS3 - Cis
    CF-causing - Trans
    CF 202heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 195heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 187heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 178heterozygoteCF-causing - Cis
    non-CF - Cis
    CF-causing - Trans
    CF 132heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 1739heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 4781heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 995heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 860heterozygoteCF-causing - Cis
    CF-causing - Trans
    Other 1640heterozygoteCF-causing- Undef
    CFTR-RD-causing- Undef
    Other 5823heterozygoteCFTR-RD-causing- Undef
    CF-causing- Undef
    non-CF- Undef
    Other 5743heterozygoteCF-causing- Undef
    CFTR-RD-causing- Undef
    Pancreatitis 2490heterozygoteCF-causing- Undef
    Pancreatitis 4240heterozygoteCF-causing - Cis
    Pancreatitis 4226heterozygoteCF-causing- Undef
    Pancreatitis 1161heterozygoteCF-causing - Cis
    Pending 1786heterozygoteCF-causing- Undef
    Bronchiectasis 2522heterozygoteCF-causing- Undef
    Bronchiectasis 2356heterozygoteCF-causing - Cis
    Pending (NBS) 4549heterozygoteCF-causing - Cis


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups (click here for more details about the classification of variants):
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare