Variant NM_000492.4:c.3140-26A>G


Variant details:
Name NM_000492.4:c.3140-26A>G
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117251609A>G    UCSC    
#Exon/intron intron 19
Legacy Name 3272-26A>G
Class disease-causing
Subclass varying clinical consequence
WT sequence ACATTTTGTGTTTATGTTATTTGCA A TGTTTTCTATGGAAATATTTCACAG
Mutant sequence ACATTTTGTGTTTATGTTATTTGCA G TGTTTTCTATGGAAATATTTCACAG

Other databases:
dbSNP
rs76151804







Pathogenicity predictors:

Not found



Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVAnononono


clinical and functional data are provided by Vertex


No patient found in CFTR-NGS catalogue


63 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 63
Asymptomatic compound heterozygote 2
CF 35
CFTR-RD17
  • Bronchiectasis  1
  • CBAVD  9
  • CRS-NP  1
  • Other  4
  • Pancreatitis  2
Pending (NBS) 9




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CRS-NP 4841heterozygoteCF-causing- Undef
CF 6184heterozygoteCF-causing - Trans
CF 4765heterozygoteVUS3- Undef
CF-causing- Undef
CF 3298heterozygoteCF-causing - Trans
CF 2882heterozygoteCF-causing- Undef
CF 2848heterozygoteCF-causing - Trans
CF 2732heterozygoteCF-causing- Undef
CF 2724heterozygoteCF-causing- Undef
CF 3426heterozygoteCF-causing- Undef
CF 6013heterozygoteCF-causing - Trans
CF 6009heterozygoteCF-causing- Undef
CF 6082heterozygoteCF-causing- Undef
CF 4483heterozygoteCF-causing- Undef
CF 4376heterozygoteCF-causing- Undef
CF 4359heterozygotevarying clinical consequence - Trans
CF 4325heterozygoteCF-causing - Trans
CF 4087heterozygoteCF-causing- Undef
CF 3816heterozygotevarying clinical consequence - Trans
CF 2630heterozygoteCF-causing- Undef
CF 4860heterozygoteCF-causing- Undef
CF 1128heterozygoteCFTR-RD-causing - Trans
CF-causing - Trans
CF 1071heterozygoteCF-causing - Trans
CF 351heterozygoteCF-causing - Trans
CF 284heterozygoteCF-causing- Undef
CF 171heterozygoteCF-causing- Undef
CF 128heterozygoteCF-causing - Trans
CF 4878heterozygoteCF-causing- Undef
CF 2452heterozygoteCF-causing- Undef
CF 2381heterozygoteCF-causing- Undef
CF 1956heterozygoteCF-causing- Undef
CF 2932heterozygoteCF-causing - Trans
CF 5867heterozygoteCF-causing- Undef
CF 1867heterozygoteCF-causing- Undef
CF 5041heterozygoteCF-causing- Undef
CF 1440heterozygoteCF-causing- Undef
CF 5667homozygotec.3140-26A>G - p.(=) - Trans
CBAVD 3373heterozygotelikely CFTR-RD- Undef
CBAVD 3292heterozygoteCF-causing- Undef
CBAVD 3264heterozygoteCF-causing- Undef
CBAVD 4577heterozygoteCFTR-RD-causing- Undef
CBAVD 535heterozygoteCF-causing - Trans
VUS3- Undef
CBAVD 467heterozygoteCF-causing- Undef
CBAVD 1354heterozygoteVUS3- Undef
CBAVD 1385heterozygoteCF-causing- Undef
CBAVD 5883homozygotec.3140-26A>G - p.(=) - Trans
Pending (NBS) 3042heterozygoteCF-causing - Trans
Pending (NBS) 2875heterozygoteCF-causing - Trans
Pending (NBS) 3763heterozygoteCF-causing - Trans
Pending (NBS) 4508heterozygoteCF-causing - Trans
Pending (NBS) 3908heterozygoteCF-causing- Undef
Pending (NBS) 1070heterozygoteCF-causing - Trans
Pending (NBS) 5280heterozygoteCF-causing - Trans
Pending (NBS) 991heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 516heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 542heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 1529heterozygoteCF-causing- Undef
Pancreatitis 2156heterozygote
Pancreatitis 1862heterozygoteCF-causing- Undef
Other 2906heterozygoteCFTR-RD-causing - Trans
Other 3608heterozygoteCF-causing - Trans
Other 4818heterozygoteCF-causing- Undef
Other 2696heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 4657heterozygoteCF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare