Variant NM_000492.4:c.3140-26A>G
| Name | NM_000492.4:c.3140-26A>G |
| Protein name | NP_000483.3:p.(=) |
| Genomic name (hg19) | chr7:g.117251609A>G UCSC |
| Genomic name (hg38) | chr7:g.117611555A>G UCSC |
| #Exon/intron | intron 19 |
| Legacy Name | 3272-26A>G |
| Class | disease-causing |
| Subclass | varying clinical consequence |
| WT sequence | ACATTTTGTGTTTATGTTATTTGCA A TGTTTTCTATGGAAATATTTCACAG |
| Mutant sequence | ACATTTTGTGTTTATGTTATTTGCA G TGTTTTCTATGGAAATATTTCACAG |
![]() |
![]() | dbSNP rs76151804 |
![]() Not found | ![]() |
| Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
| IVA | yes | no | no | yes |
| TEZ-IVA | yes | yes | no | yes |
| ELX-TEZ-IVA | yes | no | no | yes |
clinical and functional data presented above are provided by Vertex
| Reference | PMID | Modulator | in vitro / ex vivo data | clinical data | Patient responsiveness |
| Burgel et al., 2024 | 39151434 | ELX-TEZ-IVA | N.D. | yes | yes |
variant responsiveness based on clinical data, sweat chloride concentration, ppFEV1, chest CT imaging before and after ETI treatment (n>3 for 6-8 weeks)
No patient found in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 64 |
|---|---|
| Asymptomatic compound heterozygote | 2 |
| CF | 36 |
| CFTR-RD | 17
|
| Pending (NBS) | 9 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CRS-NP | 4841 | heterozygote | CF-causing- Undef |
| CF | 6184 | heterozygote | CF-causing - Trans |
| CF | 4765 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 3298 | heterozygote | CF-causing - Trans |
| CF | 2932 | heterozygote | CF-causing - Trans |
| CF | 2882 | heterozygote | CF-causing- Undef |
| CF | 2848 | heterozygote | CF-causing - Trans |
| CF | 2732 | heterozygote | CF-causing- Undef |
| CF | 2724 | heterozygote | CF-causing- Undef |
| CF | 3426 | heterozygote | CF-causing- Undef |
| CF | 6013 | heterozygote | CF-causing - Trans |
| CF | 6009 | heterozygote | CF-causing- Undef |
| CF | 6082 | heterozygote | CF-causing- Undef |
| CF | 4483 | heterozygote | CF-causing- Undef |
| CF | 4376 | heterozygote | CF-causing- Undef |
| CF | 4359 | heterozygote | varying clinical consequence - Trans |
| CF | 4325 | heterozygote | CF-causing - Trans |
| CF | 4087 | heterozygote | CF-causing- Undef |
| CF | 3816 | heterozygote | varying clinical consequence - Trans |
| CF | 2630 | heterozygote | CF-causing- Undef |
| CF | 1128 | heterozygote | CF-causing - Trans |
| CF | 1071 | heterozygote | CF-causing - Trans |
| CF | 6544 | heterozygote | CF-causing- Undef |
| CF | 351 | heterozygote | CF-causing - Trans |
| CF | 284 | heterozygote | CF-causing- Undef |
| CF | 171 | heterozygote | CF-causing- Undef |
| CF | 128 | heterozygote | CF-causing - Trans |
| CF | 4860 | heterozygote | CF-causing- Undef |
| CF | 4878 | heterozygote | CF-causing- Undef |
| CF | 2452 | heterozygote | CF-causing- Undef |
| CF | 2381 | heterozygote | CF-causing- Undef |
| CF | 1956 | heterozygote | CF-causing- Undef |
| CF | 5867 | heterozygote | CF-causing- Undef |
| CF | 1867 | heterozygote | CF-causing- Undef |
| CF | 5041 | heterozygote | CF-causing- Undef |
| CF | 1440 | heterozygote | CF-causing- Undef |
| CF | 5667 | homozygote | c.3140-26A>G - p.(=) - Trans |
| CBAVD | 3373 | heterozygote | likely CFTR-RD- Undef |
| CBAVD | 3292 | heterozygote | CF-causing- Undef |
| CBAVD | 3264 | heterozygote | CF-causing- Undef |
| CBAVD | 4577 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 535 | heterozygote | CF-causing - Trans VUS3- Undef |
| CBAVD | 467 | heterozygote | CF-causing- Undef |
| CBAVD | 1354 | heterozygote | VUS3- Undef |
| CBAVD | 1385 | heterozygote | CF-causing- Undef |
| CBAVD | 5883 | homozygote | c.3140-26A>G - p.(=) - Trans |
| Pending (NBS) | 3042 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 2875 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 4508 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 3908 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 3763 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 1070 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 5280 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 991 | heterozygote | |
| Pending (NBS) | 516 | heterozygote | CF-causing - Trans |
| Asymptomatic compound heterozygote | 542 | heterozygote | CF-causing - Trans |
| Asymptomatic compound heterozygote | 1529 | heterozygote | CF-causing- Undef |
| Pancreatitis | 2156 | heterozygote | |
| Pancreatitis | 1862 | heterozygote | CF-causing- Undef |
| Other | 2906 | heterozygote | CFTR-RD-causing - Trans |
| Other | 3608 | heterozygote | CF-causing - Trans |
| Other | 4818 | heterozygote | CF-causing- Undef |
| Other | 2696 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 4657 | heterozygote | CF-causing- Undef |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|