Updates for c.3154T>G:
2018-03-26 class changed from unclassified to disease-causing and subclass to CFTR-RD-causing
2024-10-14 Class updated from CFTR-RD-causing to non disease-causing
2024-12-09 Variant classified as non-disease-causing on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data




Variant NM_000492.4:c.3154T>G


Variant details:
Name NM_000492.4:c.3154T>G
Protein name NP_000483.3:p.(Phe1052Val)
Genomic name (hg19)     chr7:g.117251649T>G    UCSC    
Genomic name (hg38) chr7:g.117611595T>G    UCSC
#Exon/intron exon 20
Legacy Name F1052V
Class non disease-causing
WT sequence ATATTTCACAGGCAGGAGTCCAATT T TCACTCATCTTGTTACAAGCTTAAA
Mutant sequence ATATTTCACAGGCAGGAGTCCAATT G TCACTCATCTTGTTACAAGCTTAAA

Other databases:
dbSNP
rs150212784



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Seibert et al, 1996 8662892
Cotten et al, 1996 8702904
Van Goor et al, 2014 23891399
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results



Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnoyesno
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


1 individuals carrying this variant are reported in CFTR-NGS catalogue


12 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 12
Asymptomatic compound heterozygote 3
CFTR-RD7
  • CBAVD  1
  • CRS-NP  1
  • Other  1
  • Pancreatitis  4
Pending 1
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending (NBS) 4694heterozygoteCF-causing - Trans
CRS-NP 5138heterozygotenon-CF- Undef
CBAVD 1399heterozygoteVUS3 - Cis
CF-causing - Trans
Pancreatitis 5155heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 2462heterozygote
Pancreatitis 6388heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
Pancreatitis 5879heterozygoteCFTR-RD-causing- Undef
Other 6325homozygotec.489+3A>G - p.(=) - Trans
Pending 4640heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4741heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 4763heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4523heterozygotevarying clinical consequence - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare