Variant NM_000492.4:c.3208C>T


Variant details:
Name NM_000492.4:c.3208C>T
Protein name NP_000483.3:p.(Arg1070Trp)
Genomic name (hg19)     chr7:g.117251703C>T    UCSC    
Genomic name (hg38) chr7:g.117611649C>T    UCSC
#Exon/intron exon 20
Legacy Name R1070W
Class disease-causing
Subclass varying clinical consequence
WT sequence ACTATGGACACTTCGTGCCTTCGGA C GGCAGCCTTACTTTGAAACTCTGTT
Mutant sequence ACTATGGACACTTCGTGCCTTCGGA T GGCAGCCTTACTTTGAAACTCTGTT

Other databases:
dbSNP
rs202179988



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Seibert et al, 1996 8662892 ✓ ✓
Mickle et al, 2000 10762539 ✓ ✓
Krasnov et al, 2008 18951463 ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


No patient found in CFTR-NGS catalogue


24 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 24
Asymptomatic compound heterozygote 1
CF 5
CFTR-RD16
  • CBAVD  12
  • CRS-NP  1
  • Other  1
  • Pancreatitis  2
Pending 1
Pending (NBS) 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 347heterozygoteCF-causing - Trans
CF 4044heterozygoteCF-causing - Trans
CF 1718heterozygoteCF-causing- Undef
CF 5699heterozygoteCF-causing- Undef
CF 6197heterozygoteCF-causing- Undef
CBAVD 4929heterozygoteCFTR-RD-causing - Trans
VUS3 - Trans
CBAVD 3062heterozygoteCF-causing - Trans
CBAVD 3322heterozygoteCF-causing - Trans
CBAVD 3323heterozygoteCF-causing - Trans
CBAVD 3332heterozygotevarying clinical consequence - Trans
CBAVD 6307heterozygoteCF-causing- Undef
CBAVD 505heterozygoteCF-causing - Trans
CBAVD 533heterozygoteCF-causing - Trans
CBAVD 5521heterozygotevarying clinical consequence- Undef
CBAVD 1132heterozygoteCFTR-RD-causing- Undef
CBAVD 1451heterozygoteCF-causing- Undef
CBAVD 6387heterozygoteCF-causing- Undef
Pending (NBS) 1087heterozygoteCF-causing - Trans
Pending 1091heterozygoteCF-causing - Trans
Pancreatitis 2417heterozygoteCFTR-RD-causing- Undef
Pancreatitis 1980heterozygoteCF-causing- Undef
Other 3022heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 3333heterozygotevarying clinical consequence - Trans
CRS-NP 6308heterozygoteCF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare