Variant NM_000492.4:c.3208C>T
Name | NM_000492.4:c.3208C>T |
Protein name | NP_000483.3:p.(Arg1070Trp) |
Genomic name (hg19) | chr7:g.117251703C>T UCSC |
#Exon/intron | exon 20 |
Legacy Name | R1070W |
Class | disease-causing |
Subclass | varying clinical consequence |
WT sequence | ACTATGGACACTTCGTGCCTTCGGA C GGCAGCCTTACTTTGAAACTCTGTT |
Mutant sequence | ACTATGGACACTTCGTGCCTTCGGA T GGCAGCCTTACTTTGAAACTCTGTT |
![]() |
![]() | dbSNP rs202179988 |
![]() | ![]() |
Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
Seibert et al, 1996 | 8662892 | ✓ | ✓ | ||||
Mickle et al, 2000 | 10762539 | ✓ | ✓ | ||||
Krasnov et al, 2008 | 18951463 | ✓ | ✓ | ||||
Van Goor et al, 2014 | 23891399 | ✓ | ✓ | ✓ | |||
Sosnay et al, 2013 | 23974870 | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | no | yes |
TEZ-IVA | yes | yes | no | yes |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 24 |
---|---|
Asymptomatic compound heterozygote | 1 |
CF | 5 |
CFTR-RD | 16
|
Pending | 1 |
Pending (NBS) | 1 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CF | 347 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 4044 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 1718 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5699 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 6197 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 4929 | heterozygote | varying clinical consequence - Cis CFTR-RD-causing - Trans VUS3 - Trans |
CBAVD | 3062 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 3322 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 3323 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 3332 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
CBAVD | 6307 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 505 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 533 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 5521 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
CBAVD | 1132 | heterozygote | varying clinical consequence- Undef CFTR-RD-causing- Undef |
CBAVD | 1451 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 6387 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 1087 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending | 1091 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pancreatitis | 2417 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Pancreatitis | 1980 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Other | 3022 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 3333 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
CRS-NP | 6308 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|