Updates for c.3485G>T:
2018-03-26 class changed from unclassified to disease-causing and subclass to CFTR-RD-causing
2024-10-14 Class updated from CFTR-RD-causing to non disease-causing
2024-12-09 Variant classified as non-disease-causing on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data




Variant NM_000492.4:c.3485G>T


Variant details:
Name NM_000492.4:c.3485G>T
Protein name NP_000483.3:p.(Arg1162Leu)
Genomic name (hg19)     chr7:g.117267592G>T    UCSC    
Genomic name (hg38) chr7:g.117627538G>T    UCSC
#Exon/intron exon 22
Legacy Name 3617G/T
Class non disease-causing
WT sequence TTATTTCAGATGCGATCTGTGAGCC G AGTCTTTAAGTTCATTGACATGCCA
Mutant sequence TTATTTCAGATGCGATCTGTGAGCC T AGTCTTTAAGTTCATTGACATGCCA

Other databases:
dbSNP
rs1800120



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results



Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnoyesno
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno

clinical and functional data presented above are provided by Vertex


2 individuals carrying this variant are reported in CFTR-NGS catalogue


14 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 14
Asymptomatic compound heterozygote 4
CFTR-RD7
  • Bronchiectasis  2
  • CBAVD  1
  • Other  2
  • Pancreatitis  2
Pending 1
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending 243heterozygote
CBAVD 963heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5004heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 2928heterozygote
Asymptomatic compound heterozygote 1935heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 5848heterozygote
Pancreatitis 4255heterozygote
Pancreatitis 2351heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2420heterozygoteCF-causing- Undef
Bronchiectasis 2406heterozygoteCFTR-RD-causing- Undef
Other 3047heterozygoteCF-causing - Trans
Other 2434heterozygoteCF-causing- Undef
Pending (NBS) 2520heterozygoteCF-causing- Undef
Pending (NBS) 6032heterozygoteCF-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare