Updates for c.349C>T:
2024-12-09 Variant classified as varying clinical consequence (low penetrance of CF) on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data




Variant NM_000492.4:c.349C>T


Variant details:
Name NM_000492.4:c.349C>T
Protein name NP_000483.3:p.(Arg117Cys)
Genomic name (hg19)     chr7:g.117171028C>T    UCSC    
Genomic name (hg38) chr7:g.117530974C>T    UCSC
#Exon/intron exon 4
Legacy Name R117C
Class disease-causing
Subclass varying clinical consequence
WT sequence CTATGACCCGGATAACAAGGAGGAA C GCTCTATCGCGATTTATCTAGGCAT
Mutant sequence CTATGACCCGGATAACAAGGAGGAA T GCTCTATCGCGATTTATCTAGGCAT

Other databases:
dbSNP
rs77834169



Pathogenicity predictors:

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Hammerle et al, 2001 11278813 ✓ ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnono yes
TEZ-IVA yes yesno yes
ELX-TEZ-IVA yesnoyes yes
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex


No patient found in CFTR-NGS catalogue


21 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 21
Asymptomatic compound heterozygote 2
CF 1
CFTR-RD14
  • Bronchiectasis  6
  • CBAVD  7
  • Other  1
Fetal bowel anomalies 1
Pending (NBS) 3




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Asymptomatic compound heterozygote 540heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4523heterozygote
Fetal bowel anomalies 545heterozygote
CBAVD 4761heterozygoteCF-causing- Undef
CBAVD 3351heterozygoteCF-causing- Undef
CBAVD 3416heterozygoteCF-causing- Undef
CBAVD 6269heterozygoteVUS3- Undef
CBAVD 1382heterozygoteCF-causing- Undef
CBAVD 546heterozygoteCF-causing - Trans
CBAVD 1350heterozygoteCF-causing- Undef
Bronchiectasis 4623heterozygoteCF-causing- Undef
Bronchiectasis 5170heterozygoteCF-causing - Trans
Bronchiectasis 5062heterozygoteCF-causing- Undef
Bronchiectasis 6330heterozygoteCF-causing- Undef
Bronchiectasis 1090heterozygoteCF-causing - Trans
VUS3 - Trans
Bronchiectasis 4848heterozygoteCF-causing - Trans
Pending (NBS) 3771heterozygoteCF-causing - Trans
Pending (NBS) 3872heterozygoteCF-causing - Trans
Pending (NBS) 6337heterozygoteCF-causing- Undef
CF 4865heterozygoteCF-causing- Undef
Other 4244heterozygoteCF-causing - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare