Variant NM_000492.4:c.350G>A


Variant details:
Name NM_000492.4:c.350G>A
Protein name NP_000483.3:p.(Arg117His)
Genomic name (hg19) chr7:g.117171029G>A    UCSC    
#Exon/intron exon 4
Legacy Name R117H
Class disease-causing
Subclass CFTR-RD-causing
WT sequence TATGACCCGGATAACAAGGAGGAAC G CTCTATCGCGATTTATCTAGGCATA
Mutant sequence TATGACCCGGATAACAAGGAGGAAC A CTCTATCGCGATTTATCTAGGCATA

Other databases:
dbSNP
rs78655421



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sheppard et al, 1993 7680769
Hammerle et al, 2001 11278813
Van Goor et al, 2014 23891399
Sosnay et al, 2013 23974870
LaRusch et al, 2014 25033378
Bergougnoux et al, 2015 25797027


« ✓ » indicates the type of analysis performed and not the results




5 individuals carrying this variant are reported in CFTR-NGS catalogue


218 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 218
Asymptomatic compound heterozygote 11
CF 5
CFTR-RD145
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  8
  • CBAVD  96
  • CRS-NP  1
  • Other  26
  • Pancreatitis  13
Fetal bowel anomalies 1
Pending 3
Pending (NBS) 52
Pending non-CF 1




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending (NBS) 5566heterozygoteCF-causing - Trans
Pending (NBS) 4616heterozygoteCF-causing - Trans
Pending (NBS) 3135heterozygoteCF-causing - Trans
Pending (NBS) 2877heterozygote
Pending (NBS) 4182heterozygoteCF-causing - Trans
Pending (NBS) 4159heterozygoteCF-causing - Trans
Pending (NBS) 4146heterozygoteCF-causing- Undef
Pending (NBS) 4122heterozygoteCF-causing- Undef
Pending (NBS) 4119heterozygoteCF-causing - Trans
Pending (NBS) 4113heterozygoteCF-causing- Undef
Pending (NBS) 4030heterozygoteCF-causing - Trans
Pending (NBS) 4019heterozygoteCF-causing- Undef
Pending (NBS) 4010heterozygoteCF-causing - Trans
Pending (NBS) 3982heterozygoteCF-causing- Undef
Pending (NBS) 4263heterozygoteCF-causing - Trans
Pending (NBS) 4555heterozygoteCF-causing- Undef
Pending (NBS) 4420heterozygote
Pending (NBS) 4410heterozygoteCF-causing - Trans
Pending (NBS) 3909heterozygoteCF-causing- Undef
Pending (NBS) 3905heterozygoteCF-causing- Undef
Pending (NBS) 3477heterozygoteCF-causing- Undef
Pending (NBS) 3472heterozygoteCF-causing- Undef
Pending (NBS) 3458heterozygoteCF-causing - Trans
Pending (NBS) 3442heterozygoteCF-causing- Undef
Pending (NBS) 3437heterozygoteCF-causing - Trans
Pending (NBS) 5573heterozygoteCF-causing - Trans
Pending (NBS) 5570heterozygoteCF-causing - Trans
Pending (NBS) 3478heterozygoteCF-causing - Trans
VUS3- Undef
Pending (NBS) 3504heterozygoteCF-causing- Undef
Pending (NBS) 3512heterozygoteCF-causing- Undef
Pending (NBS) 3787heterozygoteCF-causing - Trans
Pending (NBS) 3775heterozygoteCF-causing - Trans
Pending (NBS) 3773heterozygoteCF-causing- Undef
Pending (NBS) 3672heterozygoteCF-causing - Trans
Pending (NBS) 3668heterozygoteCF-causing - Trans
Pending (NBS) 3663heterozygoteCF-causing - Trans
Pending (NBS) 3648heterozygoteCF-causing - Trans
Pending (NBS) 3590heterozygoteCF-causing- Undef
Pending (NBS) 3579heterozygoteCF-causing- Undef
Pending (NBS) 944heterozygoteCF-causing - Trans
Pending (NBS) 785heterozygoteCF-causing - Trans
Pending (NBS) 5254heterozygoteCF-causing - Trans
Pending (NBS) 769heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 644heterozygoteCF-causing - Trans
Pending (NBS) 52heterozygoteCF-causing - Trans
Pending (NBS) 2212heterozygotevarying clinical consequence- Undef
Pending (NBS) 2183heterozygoteCF-causing- Undef
Pending (NBS) 1514heterozygoteCF-causing - Trans
Pending (NBS) 1513heterozygoteCF-causing - Trans
Pending (NBS) 3667homozygotec.350G>A - p.(Arg117His) - Trans
Pending (NBS) 4123homozygotec.350G>A - p.(Arg117His) - Trans
Pending (NBS) 566homozygotec.350G>A - p.(Arg117His) - Trans
Pancreatitis 4642heterozygoteCF-causing- Undef
Pancreatitis 5154heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4743heterozygoteCF-causing- Undef
Pancreatitis 3163heterozygotevarying clinical consequence - Trans
Pancreatitis 2591heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2811heterozygote
Pancreatitis 2907heterozygote
Pancreatitis 6188heterozygoteCF-causing - Trans
Pancreatitis 4318heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4692heterozygotevarying clinical consequence- Undef
Pancreatitis 5708heterozygoteCF-causing- Undef
Pancreatitis 5397heterozygoteCF-causing- Undef
Pancreatitis 1961heterozygote
CBAVD 3331heterozygoteCF-causing - Trans
CBAVD 3321heterozygote
CBAVD 3279heterozygoteCF-causing- Undef
CBAVD 3273heterozygoteCF-causing- Undef
CBAVD 3266heterozygoteCF-causing- Undef
CBAVD 3265heterozygoteCF-causing - Trans
CBAVD 3241heterozygoteCF-causing- Undef
CBAVD 3334heterozygotevarying clinical consequence - Trans
CBAVD 3343heterozygoteCF-causing- Undef
CBAVD 3355heterozygoteCF-causing- Undef
CBAVD 3415heterozygoteCF-causing - Trans
CBAVD 3391heterozygoteCF-causing- Undef
CBAVD 4750heterozygoteCF-causing- Undef
CBAVD 3381heterozygotevarying clinical consequence- Undef
CBAVD 3374heterozygotevarying clinical consequence- Undef
CBAVD 3372heterozygoteCF-causing - Trans
CBAVD 3371heterozygoteCF-causing - Trans
CBAVD 2742heterozygoteCF-causing - Trans
CBAVD 2734heterozygoteCF-causing- Undef
CBAVD 2714heterozygoteCF-causing- Undef
CBAVD 2700heterozygoteCF-causing- Undef
CBAVD 2693heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 2609heterozygoteVUS1- Undef
CBAVD 4929heterozygoteVUS3 - Cis
varying clinical consequence - Trans
CBAVD 2481heterozygote
CBAVD 2885heterozygoteCFTR-RD-causing- Undef
CBAVD 4597heterozygotevarying clinical consequence- Undef
CBAVD 4576heterozygoteCFTR-RD-causing- Undef
CBAVD 4575heterozygoteCF-causing- Undef
CBAVD 4472heterozygoteCF-causing- Undef
CBAVD 5945heterozygoteCF-causing- Undef
CBAVD 5766heterozygotevarying clinical consequence - Trans
CBAVD 5281heterozygoteCFTR-RD-causing - Trans
CBAVD 1372heterozygoteCF-causing - Trans
CBAVD 931heterozygoteCF-causing - Trans
CBAVD 893heterozygoteCF-causing - Trans
CBAVD 832heterozygoteCF-causing - Trans
CBAVD 1364heterozygoteCF-causing - Trans
CBAVD 1362heterozygoteCF-causing - Trans
CBAVD 1361heterozygoteCF-causing - Trans
CBAVD 1347heterozygoteCF-causing - Trans
CBAVD 1341heterozygoteCF-causing - Trans
CBAVD 4850heterozygoteCFTR-RD-causing - Trans
CBAVD 1268heterozygoteCF-causing- Undef
CBAVD 1030heterozygotevarying clinical consequence- Undef
CBAVD 506heterozygoteCF-causing- Undef
CBAVD 479heterozygoteCF-causing- Undef
CBAVD 478heterozygoteCF-causing- Undef
CBAVD 438heterozygoteCF-causing - Trans
CBAVD 427heterozygoteCF-causing- Undef
CBAVD 409heterozygoteCF-causing- Undef
CBAVD 403heterozygoteVUS1 - Trans
CF-causing - Trans
CBAVD 4724heterozygoteCF-causing- Undef
CBAVD 512heterozygoteCFTR-RD-causing - Trans
CBAVD 520heterozygoteCF-causing- Undef
CBAVD 728heterozygoteCF-causing- Undef
CBAVD 724heterozygoteCF-causing - Trans
CBAVD 721heterozygoteCF-causing - Trans
CBAVD 717heterozygoteCF-causing - Trans
CBAVD 675heterozygoteCF-causing- Undef
CBAVD 650heterozygoteCF-causing- Undef
CBAVD 640heterozygoteCF-causing- Undef
CBAVD 633heterozygoteCF-causing- Undef
CBAVD 5874heterozygoteVUS3- Undef
CBAVD 5665heterozygoteVUS3 - Trans
CBAVD 1893heterozygoteCF-causing- Undef
CBAVD 4979heterozygoteCF-causing- Undef
CBAVD 6277heterozygoteCF-causing- Undef
CBAVD 2336heterozygoteCFTR-RD-causing- Undef
CBAVD 2263heterozygoteCF-causing- Undef
CBAVD 2208heterozygoteCF-causing- Undef
CBAVD 2025heterozygoteCF-causing- Undef
CBAVD 2004heterozygoteCF-causing- Undef
CBAVD 1979heterozygotevarying clinical consequence- Undef
CBAVD 1774heterozygoteCF-causing- Undef
CBAVD 1745heterozygoteVUS3- Undef
CBAVD 1467heterozygoteCF-causing - Trans
CBAVD 1439heterozygoteCF-causing - Trans
CBAVD 1437heterozygoteCF-causing - Trans
CBAVD 1435heterozygoteCF-causing - Trans
CBAVD 1433heterozygoteCF-causing - Trans
CBAVD 1430heterozygoteCF-causing - Trans
CBAVD 1429heterozygoteCF-causing - Trans
CBAVD 1425heterozygoteCF-causing - Trans
CBAVD 1419heterozygoteCFTR-RD-causing- Undef
CBAVD 1397heterozygoteCF-causing - Trans
CBAVD 1394heterozygoteCFTR-RD-causing - Trans
CBAVD 1393heterozygoteCFTR-RD-causing- Undef
CBAVD 1378heterozygoteCF-causing - Trans
CBAVD 1470heterozygoteCF-causing - Trans
CBAVD 1475heterozygoteCF-causing - Trans
CBAVD 1504heterozygotevarying clinical consequence- Undef
CBAVD 1496heterozygoteCF-causing - Trans
CBAVD 1482heterozygotevarying clinical consequence- Undef
CBAVD 1480heterozygoteCF-causing - Trans
CBAVD 701homozygotec.350G>A - p.(Arg117His) - Trans
Asymptomatic compound heterozygote 3019heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4259heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 4260heterozygoteVUS3 - Trans
Asymptomatic compound heterozygote 5333heterozygotenon-CF - Trans
Asymptomatic compound heterozygote 959heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 925heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 778heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 768heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4955heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 4736heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 2383heterozygoteCF-causing- Undef
Fetal bowel anomalies 621heterozygote
Bronchiectasis 5005heterozygoteCF-causing- Undef
Bronchiectasis 2502heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2960heterozygote
Bronchiectasis 3698heterozygoteCF-causing- Undef
Bronchiectasis 693heterozygoteCF-causing - Trans
VUS1- Undef
Bronchiectasis 2344heterozygote
Bronchiectasis 5000heterozygoteCF-causing - Trans
Bronchiectasis 2280heterozygoteCF-causing- Undef
Other 3246heterozygoteCF-causing - Trans
Other 3233heterozygoteCF-causing - Trans
Other 3397heterozygoteCF-causing - Trans
Other 3167heterozygoteCF-causing - Trans
Other 4927heterozygotevarying clinical consequence- Undef
Other 2829heterozygoteCF-causing - Trans
Other 2834heterozygoteCF-causing - Trans
Other 3141heterozygoteCF-causing - Trans
Other 2906heterozygotevarying clinical consequence - Trans
Other 2874heterozygoteCF-causing - Trans
Other 4292heterozygoteCF-causing - Trans
Other 4810heterozygoteCF-causing- Undef
Other 4801heterozygoteCF-causing- Undef
Other 5625heterozygoteCF-causing - Trans
Other 5567heterozygoteCF-causing - Trans
Other 877heterozygoteCF-causing - Trans
Other 815heterozygoteCF-causing - Trans
Other 789heterozygoteCF-causing- Undef
Other 983heterozygoteCF-causing - Trans
Other 1184heterozygotevarying clinical consequence- Undef
Other 1158heterozygoteCF-causing- Undef
Other 1141heterozygoteCF-causing- Undef
Other 752heterozygoteCF-causing - Trans
Other 5666heterozygoteVUS3- Undef
Other 1640heterozygoteCF-causing- Undef
VUS3- Undef
Other 1676heterozygoteCF-causing- Undef
Pending 1544heterozygoteCF-causing - Trans
Pending 1990heterozygoteCF-causing- Undef
Pending 2428heterozygoteCF-causing- Undef
CF 4418heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
VUS3- Undef
CF 6246heterozygoteVUS3- Undef
CF-causing- Undef
CF 4973heterozygoteCF-causing- Undef
CF 2182heterozygoteCF-causing- Undef
CF 1562heterozygoteCF-causing - Trans
Aquagenic palmoplantar keratoderma 5702heterozygoteVUS3- Undef
CRS-NP 3088heterozygoteCF-causing - Trans
Pending non-CF 3094heterozygotevarying clinical consequence - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare