Updates for c.3528del:
2023-02-02 name changed from c.3528delC to c.3528del




Variant NM_000492.4:c.3528del


Variant details:
Name NM_000492.4:c.3528del
Protein name NP_000483.3:p.(Lys1177Serfs*15)
Genomic name (hg19)     chr7:g.117267635del    UCSC    
Genomic name (hg38) chr7:g.117627581del    UCSC
#Exon/intron exon 22
Legacy Name 3659delC
Class disease-causing
Subclass CF-causing
WT sequence ACATGCCAACAGAAGGTAAACCTAC C AAGTCAACCAAACCATACAAGAATG
Mutant sequence ACATGCCAACAGAAGGTAAACCTAC - AAGTCAACCAAACCATACAAGAATG

Other databases:
dbSNP
rs121908747







Pathogenicity predictors:

Not found




Response to modulators:


Reference PMID Modulator in vitro / ex vivo data clinical data Patient responsiveness
Burgel et al., 2024 39151434 ELX-TEZ-IVAN.D. yesno



No patient found in CFTR-NGS catalogue


31 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 31
Asymptomatic compound heterozygote 1
CF 26
CFTR-RD1
  • CBAVD  1
Fetal bowel anomalies 1
Pending 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending 4819heterozygote
Pending 2228heterozygoteCFTR-RD-causing- Undef
CF 2029heterozygoteCF-causing - Trans
CF 3481heterozygoteCF-causing- Undef
CF 3603heterozygoteCF-causing- Undef
CF 3839heterozygoteCF-causing- Undef
CF 4381heterozygoteCF-causing- Undef
CF 4413heterozygoteCF-causing - Trans
CF 4443heterozygoteCF-causing - Trans
CF 4460heterozygoteCF-causing - Trans
CF 4496heterozygoteCF-causing - Trans
CF 4538heterozygoteCFTR-RD-causing - Trans
CF-causing - Trans
CF 1975heterozygoteCF-causing- Undef
CF 1933heterozygoteCF-causing- Undef
CF 1790heterozygoteCF-causing- Undef
CF 209heterozygoteCF-causing- Undef
CF 303heterozygoteCF-causing - Trans
CF 365heterozygoteCF-causing - Trans
CF 368heterozygoteCF-causing - Trans
CF 502heterozygoteCF-causing- Undef
CF 953heterozygoteCF-causing - Trans
CF 989heterozygoteCF-causing- Undef
CF 5227heterozygoteCF-causing - Trans
CF 5526heterozygoteCF-causing - Trans
CF 1086heterozygoteCF-causing- Undef
CF 1629heterozygoteCF-causing- Undef
CF 1717heterozygoteCF-causing- Undef
CF 6525heterozygotenon-CF- Undef
CBAVD 1308heterozygoteCFTR-RD-causing- Undef
Fetal bowel anomalies 4802heterozygote
Asymptomatic compound heterozygote 4345heterozygote


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare