Variant NM_000492.4:c.3731G>A


Variant details:
Name NM_000492.4:c.3731G>A
Protein name NP_000483.3:p.(Gly1244Glu)
Genomic name (hg19) chr7:g.117282505G>A    UCSC    
#Exon/intron exon 23
Legacy Name G1244E
Class disease-causing
Subclass CF-causing
WT sequence TTTACCTTATAGGTGGGCCTCTTGG G AAGAACTGGATCAGGGAAGAGTACT
Mutant sequence TTTACCTTATAGGTGGGCCTCTTGG A AAGAACTGGATCAGGGAAGAGTACT

Other databases:
dbSNP
rs267606723



Pathogenicity predictors:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Anderson and Welsh, 1992 1382316
Yu et al, 2012 22293084
Sosnay et al, 2013 23974870


« ✓ » indicates the type of analysis performed and not the results



Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yes yesno yes
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


1 individuals carrying this variant are reported in CFTR-NGS catalogue


18 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 18
CF 11
CFTR-RD4
  • CBAVD  2
  • Other  2
Fetal bowel anomalies 1
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 32heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3871heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2494heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2094heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2008heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1973heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5861heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1578heterozygoteCF-causing - Cis
CF-causing - Trans
CF 111heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 4845heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1534homozygotec.3731G>A - p.(Gly1244Glu) - Trans
Other 4705heterozygoteCF-causing - Cis
CF-causing - Trans
Other 4809heterozygoteVUS3- Undef
CF-causing- Undef
Fetal bowel anomalies 4709heterozygoteCF-causing - Cis
CF-causing - Trans
CBAVD 539heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CBAVD 427heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 803heterozygoteCF-causing - Cis
VUS2 - Trans


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare