Variant NM_000492.4:c.3752G>A


Variant details:
Name NM_000492.4:c.3752G>A
Protein name NP_000483.3:p.(Ser1251Asn)
Genomic name (hg19)     chr7:g.117282526G>A    UCSC    
Genomic name (hg38) chr7:g.117642472G>A    UCSC
#Exon/intron exon 23
Legacy Name S1251N
Class disease-causing
Subclass CF-causing
complex allele in 35.00% of patients associated with
  • c.1523T>G - p.(Phe508Cys) : 100.00%
    • WT sequence TTGGGAAGAACTGGATCAGGGAAGA G TACTTTGTTATCAGCTTTTTTGAGA
    Mutant sequence TTGGGAAGAACTGGATCAGGGAAGA A TACTTTGTTATCAGCTTTTTTGAGA

    Other databases:
    dbSNP
    rs74503330



    Pathogenicity predictors:

    Functional studies:         +


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Yu et al, 2012 22293084 ✓ ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:         +


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yes yesno yes
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno
    VNZ-TEZ-DIVA yesnono yes

    clinical and functional data presented above are provided by Vertex


    No patient found in CFTR-NGS catalogue


    20 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 20
    CF 17
    CFTR-RD3
    • Bronchiectasis  1
    • CBAVD  1
    • CRS-NP  1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CF 88heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 2735heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 2850heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 2854heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 2998heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 3584heterozygoteCF-causing - Trans
    CF 3864heterozygoteCF-causing - Trans
    CF 3925heterozygoteCF-causing- Undef
    CF 6509heterozygoteCF-causing- Undef
    CF 2554heterozygotevarying clinical consequence- Undef
    CF 642heterozygoteCF-causing - Trans
    CF 696heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 1736heterozygoteCF-causing- Undef
    CF 2081heterozygoteCF-causing- Undef
    CF 2082heterozygoteCF-causing- Undef
    CF 2262heterozygoteCF-causing - Trans
    VUS3 - Trans
    CF 3926heterozygoteCF-causing- Undef
    CRS-NP 6336heterozygoteCFTR-RD-causing- Undef
    varying clinical consequence- Undef
    CBAVD 2460heterozygoteCFTR-RD-causing- Undef
    varying clinical consequence- Undef
    Bronchiectasis 2988heterozygoteCFTR-RD-causing - Cis
    varying clinical consequence - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups (click here for more details about the classification of variants):
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare