Variant NM_000492.4:c.3808G>A


Variant details:
Name NM_000492.4:c.3808G>A
Protein name NP_000483.3:p.(Asp1270Asn)
Genomic name (hg19) chr7:g.117282582G>A    UCSC    
#Exon/intron exon 23
Legacy Name D1270N
Class non disease-causing
complex allele in 69.33% of patients associated with
  • c.601G>A - p.(Val201Met) : 69.23%
  • c.220C>T - p.(Arg74Trp) : 100.00%
    • WT sequence GAACACTGAAGGAGAAATCCAGATC G ATGGTGTGTCTTGGGATTCAATAAC
    Mutant sequence GAACACTGAAGGAGAAATCCAGATC A ATGGTGTGTCTTGGGATTCAATAAC


    Effects of associated complex alleles:
    R74W non disease-causing
    V201M likely benign
    R74W ; D1270N non disease-causing
    R74W ; V201M ; D1270N disease-causing - CFTR-RD-causing




    Other databases:
    dbSNP
    rs11971167



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Mickle et al, 2000 10762539 ✓ ✓
    Van Goor et al, 2014 23891399 ✓ ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓
    LaRusch et al, 2014 25033378 ✓ ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnoyesno
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    2 individuals carrying this variant are reported in CFTR-NGS catalogue


    75 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 75
    Asymptomatic compound heterozygote 7
    CF 4
    CFTR-RD51
    • Aquagenic palmoplantar keratoderma  1
    • Bronchiectasis  3
    • CBAVD  25
    • CRS-NP  2
    • Other  7
    • Pancreatitis  13
    Pending 5
    Pending (NBS) 8




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    Other 3076heterozygoteCF-causing - Trans
    Other 4767heterozygoteCF-causing - Trans
    Other 5075heterozygoteVUS3 - Cis
    CF-causing - Trans
    Other 1124heterozygotevarying clinical consequence- Undef
    Other 4702heterozygoteVUS3 - Cis
    CF-causing - Trans
    Other 5383heterozygoteVUS3 - Cis
    CF-causing - Trans
    Other 3138homozygotec.601G>A - p.(Val201Met) - Trans
    Pending 3073heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending 4337heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending 4336heterozygoteCF-causing - Trans
    Pending 4078heterozygoteCF-causing- Undef
    Pending 4819heterozygoteCF-causing- Undef
    CBAVD 2347heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    CBAVD 6222heterozygoteVUS3 - Cis
    CF-causing - Trans
    CBAVD 5875heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 5872heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    CBAVD 3208heterozygoteVUS3 - Cis
    CF-causing- Undef
    CBAVD 4556heterozygoteVUS3 - Cis
    CF-causing- Undef
    CBAVD 4224heterozygoteVUS3 - Cis
    VUS2 - Trans
    CBAVD 3324heterozygoteVUS3 - Cis
    CF-causing - Trans
    CBAVD 5866heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 5519heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 5223heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 892heterozygotevarying clinical consequence- Undef
    VUS3- Undef
    CBAVD 751heterozygoteVUS3 - Cis
    CF-causing - Trans
    CBAVD 697heterozygoteVUS3 - Cis
    varying clinical consequence - Trans
    CBAVD 565heterozygoteVUS3 - Cis
    VUS3- Undef
    VUS1- Undef
    CBAVD 543heterozygoteVUS3 - Cis
    CF-causing - Trans
    CBAVD 503heterozygoteCFTR-RD-causing- Undef
    VUS3- Undef
    CBAVD 4956heterozygotevarying clinical consequence- Undef
    VUS3- Undef
    CBAVD 1412heterozygoteVUS3 - Cis
    varying clinical consequence- Undef
    CBAVD 1366heterozygoteVUS3 - Cis
    CF-causing- Undef
    CBAVD 1294heterozygoteVUS3 - Cis
    CFTR-RD-causing- Undef
    CBAVD 1269heterozygoteCF-causing- Undef
    VUS3- Undef
    CBAVD 507homozygotec.601G>A - p.(Val201Met) - Trans
    CBAVD 660homozygotec.601G>A - p.(Val201Met) - Trans
    CBAVD 1456homozygotec.601G>A - p.(Val201Met) - Trans
    Asymptomatic compound heterozygote 2777heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3156heterozygoteVUS3 - Cis
    CF-causing - Trans
    Asymptomatic compound heterozygote 4517heterozygote
    Asymptomatic compound heterozygote 3794heterozygoteVUS3 - Cis
    CF-causing - Trans
    Asymptomatic compound heterozygote 314heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 4989heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 782homozygotec.601G>A - p.(Val201Met) - Trans
    CF 5993heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans
    CF 382heterozygoteVUS3 - Cis
    VUS3 - Cis
    CF-causing - Trans
    CF 5285heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 5059heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 6090heterozygoteCF-causing- Undef
    VUS3- Undef
    Pending (NBS) 5996heterozygoteCF-causing- Undef
    Pending (NBS) 4593heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 5313heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 5853heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 991heterozygotevarying clinical consequence- Undef
    Pending (NBS) 5703heterozygoteVUS3 - Cis
    VUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 5446heterozygoteVUS3 - Cis
    CF-causing - Trans
    Aquagenic palmoplantar keratoderma 5470heterozygoteVUS3 - Cis
    CFTR-RD-causing- Undef
    Pancreatitis 2302heterozygote
    Pancreatitis 4894heterozygote
    Pancreatitis 2538heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2327heterozygote
    Pancreatitis 2242heterozygoteVUS3 - Cis
    CFTR-RD-causing- Undef
    Pancreatitis 2137heterozygoteVUS3 - Cis
    CF-causing- Undef
    Pancreatitis 2033heterozygoteCF-causing- Undef
    Pancreatitis 5623heterozygoteVUS3 - Cis
    CFTR-RD-causing - Trans
    Pancreatitis 5620heterozygoteVUS3 - Cis
    Pancreatitis 3315heterozygoteVUS2 - Trans
    Pancreatitis 5869heterozygoteVUS3- Undef
    Pancreatitis 5396heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pancreatitis 5741heterozygoteCF-causing- Undef
    Bronchiectasis 5896heterozygoteVUS3- Undef
    Bronchiectasis 5464heterozygoteCFTR-RD-causing- Undef
    Bronchiectasis 5897heterozygoteCFTR-RD-causing- Undef
    non-CF- Undef
    CRS-NP 3143heterozygoteVUS3 - Cis
    CF-causing - Trans
    CRS-NP 5994heterozygoteCFTR-RD-causing - Cis
    CF-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare