Variant NM_000492.4:c.3874-200G>A
| Name | NM_000492.4:c.3874-200G>A |
| Protein name | NP_000483.3:p.(=) |
| Genomic name (hg19) | chr7:g.117292696G>A UCSC |
| Genomic name (hg38) | chr7:g.117652642G>A UCSC |
| #Exon/intron | intron 23 |
| Legacy Name | 4006-200G/A |
| Class | non disease-causing |
| WT sequence | TTCACAAGGGACTCCAAATATTGCT G TAGTATTTGTTTCTTAAAAGAATGA |
| Mutant sequence | TTCACAAGGGACTCCAAATATTGCT A TAGTATTTGTTTCTTAAAAGAATGA |
![]() | ![]() Not found | dbSNP rs214164 |
![]() Not found | ![]() |
48 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 98 |
|---|---|
| Asymptomatic compound heterozygote | 2 |
| CF | 17 |
| CFTR-RD | 71
|
| Pending | 2 |
| Pending (NBS) | 6 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| Pending | 243 | heterozygote | |
| Pending | 1097 | heterozygote | varying clinical consequence - Cis VUS3 - Trans |
| CF | 2361 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2442 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2459 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4535 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4538 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef CF-causing- Undef |
| CF | 2489 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 2495 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2568 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4785 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 4782 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 281 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 654 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1128 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 2333 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1138 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1139 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1170 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CBAVD | 2421 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 2411 | heterozygote | |
| CBAVD | 2485 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 3125 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 4534 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4536 | heterozygote | CF-causing- Undef |
| CBAVD | 5018 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 2525 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4612 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 1052 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
| CBAVD | 1056 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 423 | heterozygote | VUS3- Undef |
| CBAVD | 658 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 659 | heterozygote | VUS3- Undef VUS3- Undef |
| CBAVD | 664 | heterozygote | |
| CBAVD | 676 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 682 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 690 | heterozygote | |
| CBAVD | 1163 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 1132 | homozygote | c.3208C>T - p.(Arg1070Trp) - Trans c.509G>A - p.(Arg170His) - Trans |
| Pending (NBS) | 4407 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4606 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending (NBS) | 2520 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 1076 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4769 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 1180 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Other | 2433 | heterozygote | VUS3- Undef |
| Other | 2434 | heterozygote | CF-causing- Undef |
| Other | 2544 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 1089 | heterozygote | varying clinical consequence - Cis |
| Other | 1099 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4783 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Other | 1124 | heterozygote | varying clinical consequence- Undef |
| Pancreatitis | 2427 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2451 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2471 | heterozygote | VUS3- Undef non-CF- Undef |
| Pancreatitis | 2473 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 2422 | heterozygote | |
| Pancreatitis | 2364 | heterozygote | |
| Pancreatitis | 2377 | heterozygote | CF-causing- Undef |
| Pancreatitis | 2408 | heterozygote | |
| Pancreatitis | 2414 | heterozygote | |
| Pancreatitis | 2418 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2483 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2486 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 2488 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2528 | heterozygote | |
| Pancreatitis | 2553 | heterozygote | CF-causing- Undef |
| Pancreatitis | 1063 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pancreatitis | 2306 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2312 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2318 | heterozygote | |
| Pancreatitis | 2319 | heterozygote | |
| Pancreatitis | 2321 | heterozygote | |
| Pancreatitis | 2322 | heterozygote | |
| Pancreatitis | 2324 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2329 | heterozygote | |
| Pancreatitis | 2338 | heterozygote | VUS3- Undef |
| Pancreatitis | 2305 | heterozygote | VUS3- Undef |
| Pancreatitis | 1161 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pancreatitis | 2285 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2424 | heterozygote | |
| Bronchiectasis | 2446 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 2367 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2409 | heterozygote | CF-causing- Undef VUS3- Undef |
| Bronchiectasis | 2419 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Bronchiectasis | 2420 | heterozygote | CF-causing- Undef |
| Bronchiectasis | 4602 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 2501 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 1096 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 1120 | heterozygote | varying clinical consequence- Undef |
| Bronchiectasis | 2342 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Bronchiectasis | 2298 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2287 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 2289 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2291 | heterozygote | CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4260 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 2966 | heterozygote | CF-causing- Undef |
| CRS-NP | 3161 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|