Variant NM_000492.4:c.3878T>G


Variant details:
Name NM_000492.4:c.3878T>G
Protein name NP_000483.3:p.(Val1293Gly)
Genomic name (hg19)     chr7:g.117292900T>G    UCSC    
Genomic name (hg38) chr7:g.117652846T>G    UCSC
#Exon/intron exon 24
Legacy Name V1293G
Class VUS
WT sequence TTCTTTTCTTTTTTGCTATAGAAAG T ATTTATTTTTTCTGGAACATTTAGA
Mutant sequence TTCTTTTCTTTTTTGCTATAGAAAG G ATTTATTTTTTCTGGAACATTTAGA

Other databases:

Not found
Not found		dbSNP
no rs



Pathogenicity predictors:



Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yesnoyesno
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno
VNZ-TEZ-DIVA yesnoyesno

clinical and functional data presented above are provided by Vertex

No patient found in CFTR-NGS catalogue

No patient found in CFTR-France




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare