Variant NM_000492.4:c.4137-139G>A
| Name | NM_000492.4:c.4137-139G>A |
| Protein name | NP_000483.3:p.(=) |
| Genomic name (hg19) | chr7:g.117305374G>A UCSC |
| Genomic name (hg38) | chr7:g.117665320G>A UCSC |
| #Exon/intron | intron 25 |
| Legacy Name | 4269-139G/A |
| Class | non disease-causing |
| WT sequence | GGTTGAAAAGCTGATTGTGGCTAAC G CTATATCAACATTATGTGAAAAGAA |
| Mutant sequence | GGTTGAAAAGCTGATTGTGGCTAAC A CTATATCAACATTATGTGAAAAGAA |
![]() | ![]() Not found | dbSNP rs4727855 |
![]() Not found | ![]() |
56 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 193 |
|---|---|
| Asymptomatic compound heterozygote | 19 |
| CF | 28 |
| CFTR-RD | 129
|
| Pending (NBS) | 16 |
| Pending non-CF | 1 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CF | 5069 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CF | 4629 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 4744 | heterozygote | CF-causing- Undef VUS3- Undef |
| CF | 4765 | heterozygote | VUS3- Undef varying clinical consequence- Undef CF-causing- Undef |
| CF | 5807 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5777 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef CF-causing- Undef |
| CF | 5622 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 5965 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 5948 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5770 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 5341 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 6432 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 5328 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 6456 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 745 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 383 | heterozygote | varying clinical consequence- Undef CF-causing- Undef CF-causing- Undef |
| CF | 4697 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4718 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4665 | heterozygote | VUS3- Undef |
| CF | 920 | heterozygote | VUS2- Undef CF-causing- Undef CF-causing- Undef |
| CF | 945 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 816 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5215 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CF | 829 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 4688 | homozygote | c.1519_1521del - p.(Ile507del) - Trans c.2657+5G>A - p.(=) - Trans |
| CF | 730 | homozygote | c.3131A>G - p.(Glu1044Gly) - Trans |
| CF | 882 | homozygote | c.1518C>G - p.(Ile506Met) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CF | 901 | homozygote | c.2657+5G>A - p.(=) - Trans |
| Other | 5175 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 4625 | heterozygote | VUS3- Undef |
| Other | 4760 | heterozygote | VUS3- Undef |
| Other | 5825 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 5823 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef VUS3- Undef |
| Other | 5743 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
| Other | 5775 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef |
| Other | 6438 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| Other | 4686 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4671 | heterozygote | VUS3- Undef |
| Other | 5083 | heterozygote | VUS3- Undef CF-causing- Undef |
| Other | 4835 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Other | 972 | heterozygote | CF-causing- Undef |
| Other | 935 | heterozygote | CFTR-RD-causing- Undef |
| Other | 940 | heterozygote | CF-causing- Undef |
| Other | 5087 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Other | 4826 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Other | 5082 | homozygote | c.1116+1G>A - p.(=) - Trans c.1210-34_1210-6TG[11]T[5] - Trans |
| CBAVD | 3267 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4752 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5173 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 5330 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4756 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4651 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 4653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5228 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CBAVD | 5229 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 2421 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 1469 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 5821 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5943 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5768 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5947 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5946 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 5944 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 6454 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
| CBAVD | 6455 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 5314 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 6458 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5346 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 676 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 664 | heterozygote | |
| CBAVD | 659 | heterozygote | VUS3- Undef VUS3- Undef |
| CBAVD | 658 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 656 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 423 | heterozygote | VUS3- Undef |
| CBAVD | 682 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 690 | heterozygote | |
| CBAVD | 781 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 765 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 763 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 743 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 735 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 710 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4706 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4683 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4679 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5072 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 4837 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4735 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 4729 | heterozygote | VUS3- Undef likely CFTR-RD- Undef |
| CBAVD | 818 | heterozygote | |
| CBAVD | 986 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 887 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 892 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 900 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 978 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 912 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 927 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4710 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef |
| CBAVD | 949 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 938 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 941 | heterozygote | VUS4- Undef CF-causing- Undef |
| CBAVD | 805 | heterozygote | VUS3- Undef |
| CBAVD | 812 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 834 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 840 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 858 | heterozygote | |
| CBAVD | 857 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 856 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5235 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.377G>A - p.(Gly126Asp) - Trans |
| CBAVD | 5129 | homozygote | c.1519_1521del - p.(Ile507del) - Trans c.1704G>T - p.(Leu568Phe) - Trans |
| CBAVD | 881 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 720 | homozygote | c.4097T>C - p.(Ile1366Thr) - Trans |
| CBAVD | 725 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| CBAVD | 908 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1466C>T - p.(Ser489Leu) - Trans c.1684G>A - p.(Val562Ile) - Trans |
| CBAVD | 919 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| Pending (NBS) | 4643 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pending (NBS) | 4631 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending (NBS) | 4645 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 4654 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5247 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef VUS1- Undef |
| Pending (NBS) | 5808 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 5769 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Pending (NBS) | 5342 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 6457 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 799 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 794 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4694 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 803 | heterozygote | VUS2- Undef CF-causing- Undef |
| Pending (NBS) | 991 | heterozygote | varying clinical consequence- Undef |
| Pending (NBS) | 5071 | homozygote | c.-288G>C - p.(=) - Trans c.2657+5G>A - p.(=) - Trans c.3139+89T>C - p.(=) - Trans |
| Pending (NBS) | 4644 | homozygote | c.1209G>C - p.(Glu403Asp) - Trans c.2657+5G>A - p.(=) - Trans |
| Pancreatitis | 4619 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 4659 | heterozygote | VUS3- Undef |
| Pancreatitis | 3259 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pancreatitis | 4849 | heterozygote | CF-causing - Cis CF-causing - Trans |
| Pancreatitis | 5621 | heterozygote | |
| Pancreatitis | 5619 | heterozygote | VUS3- Undef |
| Pancreatitis | 5617 | heterozygote | VUS3- Undef |
| Pancreatitis | 5614 | heterozygote | VUS3- Undef |
| Pancreatitis | 5611 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 5605 | heterozygote | VUS2- Undef |
| Pancreatitis | 5364 | heterozygote | VUS3- Undef |
| Pancreatitis | 5977 | heterozygote | VUS3- Undef |
| Pancreatitis | 5974 | heterozygote | VUS3- Undef |
| Pancreatitis | 5340 | heterozygote | VUS3- Undef |
| Pancreatitis | 5336 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5155 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5165 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 669 | heterozygote | CF-causing- Undef |
| Pancreatitis | 648 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 4708 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 5171 | homozygote | c.-461A>G - p.(=) - Trans c.980T>G - p.(Leu327Arg) - Trans |
| Bronchiectasis | 4657 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 4870 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Bronchiectasis | 4848 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5624 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 6435 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5972 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 693 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS3- Undef |
| Bronchiectasis | 4725 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Bronchiectasis | 4726 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5126 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans |
| Bronchiectasis | 966 | homozygote | c.1585-9418T>C - p.(=) - Trans c.899C>A - p.(Ala300Asp) - Trans |
| Bronchiectasis | 777 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans |
| Bronchiectasis | 5074 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans |
| Bronchiectasis | 5076 | homozygote | c.2658-77T>A - p.(=) - Trans |
| Asymptomatic compound heterozygote | 4617 | heterozygote | VUS3 - Cis CF-causing - Trans |
| Asymptomatic compound heterozygote | 4628 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4763 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 5133 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 5140 | heterozygote | VUS3- Undef CF-causing- Undef |
| Asymptomatic compound heterozygote | 5141 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 5606 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CF-causing- Undef |
| Asymptomatic compound heterozygote | 5964 | heterozygote | VUS3- Undef CF-causing- Undef |
| Asymptomatic compound heterozygote | 6437 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 6434 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 5077 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 5081 | heterozygote | |
| Asymptomatic compound heterozygote | 5073 | heterozygote | |
| Asymptomatic compound heterozygote | 5220 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Asymptomatic compound heterozygote | 5218 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.2758G>T - p.(Val920Leu) - Trans c.3409A>G - p.(Met1137Val) - Trans |
| Asymptomatic compound heterozygote | 5745 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.3256A>G - p.(Thr1086Ala) - Trans |
| Asymptomatic compound heterozygote | 5362 | homozygote | c.1696G>A - p.(Ala566Thr) - Trans c.2743G>C - p.(Val915Leu) - Trans |
| Asymptomatic compound heterozygote | 4741 | homozygote | c.489+3A>G - p.(=) - Trans |
| Asymptomatic compound heterozygote | 5167 | homozygote | c.3718-2477C>T - p.(=) - Trans |
| Pending non-CF | 4825 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
| CRS-NP | 5138 | heterozygote | non-CF- Undef |
| CRS-NP | 5531 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| Aquagenic palmoplantar keratoderma | 5822 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Aquagenic palmoplantar keratoderma | 5613 | heterozygote | non-CF- Undef |
| Aquagenic palmoplantar keratoderma | 4660 | homozygote | c.2657+5G>A - p.(=) - Trans |
| Aquagenic palmoplantar keratoderma | 5149 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1521_1523del - p.(Phe508del) - Trans |
| Aquagenic palmoplantar keratoderma | 5772 | homozygote | c.4139C>T - p.(Thr1380Ile) - Trans |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|