Variant NM_000492.4:c.4242+71G>T


Variant details:
Name NM_000492.4:c.4242+71G>T
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117305689G>T    UCSC    
Genomic name (hg38) chr7:g.117665635G>T    UCSC
#Exon/intron intron 26
Class VUS
WT sequence CTTGATAACAATCTCACATGTGATA G TTCCTGCAAATTGCAACAATGTACA
Mutant sequence CTTGATAACAATCTCACATGTGATA T TTCCTGCAAATTGCAACAATGTACA

Other databases:

Not found
Not found		dbSNP
no rs







Pathogenicity predictors:

Not found

Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Bergougnoux et al, 2015 25797027 ✓


« ✓ » indicates the type of analysis performed and not the results


No patient found in CFTR-NGS catalogue

No patient found in CFTR-France




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare