Variant NM_000492.4:c.4389G>A
| Name | NM_000492.4:c.4389G>A |
| Protein name | NP_000483.3:p.(=) |
| Genomic name (hg19) | chr7:g.117307108G>A UCSC |
| Genomic name (hg38) | chr7:g.117667054G>A UCSC |
| #Exon/intron | exon 27 |
| Legacy Name | Q1463Q (4521G/A) |
| Class | non disease-causing |
| WT sequence | CAAGCAAGTGCAAGTCTAAGCCCCA G ATTGCTGCTCTGAAAGAGGAGACAG |
| Mutant sequence | CAAGCAAGTGCAAGTCTAAGCCCCA A ATTGCTGCTCTGAAAGAGGAGACAG |
![]() | ![]() Not found | dbSNP rs1800136 |
![]() Not found | ![]() |
56 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 520 |
|---|---|
| Asymptomatic compound heterozygote | 30 |
| CF | 130 |
| CFTR-RD | 317
|
| Pending | 6 |
| Pending (NBS) | 33 |
| Pending non-CF | 4 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| CF | 3021 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
| CF | 3026 | heterozygote | VUS3 - Cis CF-causing - Cis CF-causing - Trans |
| CF | 4633 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4759 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 3005 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2999 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2898 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 2947 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2962 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 5069 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CF | 4629 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 3223 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 3097 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 3140 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 3193 | heterozygote | CF-causing - Cis CF-causing - Trans |
| CF | 3200 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 3217 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2888 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2333 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2361 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2442 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2568 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2760 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 2761 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2821 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
| CF | 2459 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2495 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2515 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 2882 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 3674 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4043 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4237 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4390 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4553 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4538 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef CF-causing- Undef |
| CF | 4535 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4439 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4480 | heterozygote | CF-causing- Undef VUS2- Undef |
| CF | 4483 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4499 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4502 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 6456 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 5328 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 6432 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 4765 | heterozygote | VUS3- Undef varying clinical consequence- Undef CF-causing- Undef |
| CF | 4744 | heterozygote | CF-causing- Undef VUS3- Undef |
| CF | 5341 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 5770 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 5948 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5965 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 5622 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 5777 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef CF-causing- Undef |
| CF | 488 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 466 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 654 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 570 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 579 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 586 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 596 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 597 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 611 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 617 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 631 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4665 | heterozygote | VUS3- Undef |
| CF | 86 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 90 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 94 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 111 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 126 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 143 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 156 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 169 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 175 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 203 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4697 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4718 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 348 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 350 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 351 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 359 | heterozygote | CF-causing- Undef CF-causing- Undef VUS3- Undef |
| CF | 361 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 369 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 379 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 383 | heterozygote | varying clinical consequence- Undef CF-causing- Undef CF-causing- Undef |
| CF | 384 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 341 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 335 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 236 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 245 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef CF-causing- Undef |
| CF | 247 | heterozygote | VUS3- Undef CF-causing- Undef |
| CF | 289 | heterozygote | CF-causing- Undef likely CF- Undef |
| CF | 294 | heterozygote | VUS1- Undef |
| CF | 305 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CF | 322 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 326 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 330 | heterozygote | CF-causing - Cis CF-causing - Trans |
| CF | 1071 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4785 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 4780 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4782 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4867 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CF | 4858 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CF | 4854 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1561 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1581 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1932 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1320 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1125 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1128 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CF | 1138 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1139 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1170 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 1178 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 745 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 920 | heterozygote | VUS2- Undef CF-causing- Undef CF-causing- Undef |
| CF | 816 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 829 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| CF | 1005 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5807 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 5215 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CF | 1006 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 945 | heterozygote | CF-causing- Undef CF-causing- Undef |
| CF | 4688 | homozygote | c.1519_1521del - p.(Ile507del) - Trans c.2657+5G>A - p.(=) - Trans |
| CF | 730 | homozygote | c.3131A>G - p.(Glu1044Gly) - Trans |
| CF | 1517 | homozygote | c.2604A>G - p.(=) - Trans c.2805_2810delinsTCAGA - p.(Pro936Glnfs*6) - Trans c.3196C>T - p.(Arg1066Cys) - Trans |
| CF | 901 | homozygote | c.2657+5G>A - p.(=) - Trans |
| CF | 5188 | homozygote | c.1792A>T - p.(Lys598*) - Trans |
| CF | 882 | homozygote | c.1518C>G - p.(Ile506Met) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CF | 153 | homozygote | c.1519_1521del - p.(Ile507del) - Trans c.861_865del - p.(Asn287Lysfs*19) - Trans |
| CF | 177 | homozygote | c.2988+1G>A - p.(=) - Trans c.54-1161_164+1603del - p.(Ser18_Glu54del) - Trans |
| Other | 3047 | heterozygote | CF-causing- Undef |
| Other | 4760 | heterozygote | VUS3- Undef |
| Other | 2906 | heterozygote | varying clinical consequence - Cis CFTR-RD-causing - Trans |
| Other | 4625 | heterozygote | VUS3- Undef |
| Other | 3247 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 2433 | heterozygote | VUS3- Undef |
| Other | 2434 | heterozygote | CF-causing- Undef |
| Other | 2544 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 2696 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Other | 5575 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 3660 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Other | 4293 | heterozygote | |
| Other | 4312 | heterozygote | CF-causing- Undef VUS2- Undef |
| Other | 4315 | heterozygote | varying clinical consequence- Undef |
| Other | 4317 | heterozygote | CF-causing- Undef |
| Other | 4278 | heterozygote | VUS3- Undef CF-causing- Undef VUS1- Undef |
| Other | 4561 | heterozygote | CF-causing- Undef non-CF- Undef |
| Other | 4570 | heterozygote | VUS3- Undef CF-causing- Undef |
| Other | 4572 | heterozygote | VUS2- Undef |
| Other | 4520 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 4615 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 6438 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| Other | 5763 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef |
| Other | 5775 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef |
| Other | 464 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 87 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 4835 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Other | 4671 | heterozygote | VUS3- Undef |
| Other | 4686 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 5083 | heterozygote | VUS3- Undef CF-causing- Undef |
| Other | 4800 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| Other | 5184 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| Other | 5187 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Other | 1089 | heterozygote | varying clinical consequence - Cis |
| Other | 4783 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Other | 5823 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef non-CF- Undef VUS3- Undef |
| Other | 5825 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 1099 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Other | 1576 | heterozygote | CF-causing- Undef VUS3- Undef |
| Other | 2277 | heterozygote | CF-causing- Undef |
| Other | 1124 | heterozygote | varying clinical consequence- Undef |
| Other | 1134 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Other | 935 | heterozygote | CFTR-RD-causing- Undef |
| Other | 940 | heterozygote | CF-causing- Undef |
| Other | 972 | heterozygote | CF-causing- Undef |
| Other | 5743 | heterozygote | CF-causing- Undef VUS3- Undef CFTR-RD-causing- Undef |
| Other | 5087 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Other | 5082 | homozygote | c.1116+1G>A - p.(=) - Trans c.1210-34_1210-6TG[11]T[5] - Trans |
| CBAVD | 4653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 3064 | heterozygote | CF-causing - Cis CFTR-RD-causing - Trans |
| CBAVD | 4651 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 4756 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4752 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5022 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 3267 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 3326 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 3125 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 3201 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 2411 | heterozygote | |
| CBAVD | 2421 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 2292 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5018 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 2853 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 2525 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 2485 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 2504 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 4291 | heterozygote | VUS3- Undef |
| CBAVD | 4311 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4814 | heterozygote | CF-causing- Undef |
| CBAVD | 4279 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4239 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 4271 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4419 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4554 | heterozygote | VUS4- Undef |
| CBAVD | 4571 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4574 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4577 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4592 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4612 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4536 | heterozygote | CF-causing- Undef |
| CBAVD | 4524 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 6454 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
| CBAVD | 6455 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 6458 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5314 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5944 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 3388 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 6459 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 5330 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5346 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5590 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5591 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5943 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5946 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 5947 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5768 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5594 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5764 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 5600 | heterozygote | VUS3- Undef |
| CBAVD | 430 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 491 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 497 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 500 | heterozygote | non-CF- Undef CF-causing- Undef |
| CBAVD | 503 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CBAVD | 505 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 511 | heterozygote | VUS3- Undef VUS3- Undef |
| CBAVD | 517 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 519 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 520 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 523 | heterozygote | likely CFTR-RD- Undef varying clinical consequence- Undef |
| CBAVD | 524 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 535 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 537 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 490 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 434 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 448 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 452 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 453 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 455 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 456 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 461 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 462 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 467 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 475 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CF-causing- Undef |
| CBAVD | 484 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 549 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 552 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 656 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 658 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 659 | heterozygote | VUS3- Undef VUS3- Undef |
| CBAVD | 664 | heterozygote | |
| CBAVD | 665 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 676 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 682 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 690 | heterozygote | |
| CBAVD | 710 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 735 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 653 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef varying clinical consequence- Undef |
| CBAVD | 556 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 614 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 615 | heterozygote | |
| CBAVD | 643 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 743 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 4837 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4735 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
| CBAVD | 4679 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 4683 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 4706 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 4710 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef |
| CBAVD | 4729 | heterozygote | VUS3- Undef likely CFTR-RD- Undef |
| CBAVD | 5072 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 389 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| CBAVD | 416 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| CBAVD | 422 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 423 | heterozygote | VUS3- Undef |
| CBAVD | 1056 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 5181 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef |
| CBAVD | 1048 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 5229 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 5228 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| CBAVD | 5235 | heterozygote | CF-causing- Undef VUS3- Undef |
| CBAVD | 5821 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 1287 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| CBAVD | 1163 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 1243 | heterozygote | likely CFTR-RD- Undef VUS3- Undef VUS2- Undef |
| CBAVD | 1248 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 858 | heterozygote | |
| CBAVD | 868 | heterozygote | CF-causing- Undef likely CFTR-RD- Undef |
| CBAVD | 887 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 892 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
| CBAVD | 900 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 912 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 927 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| CBAVD | 938 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 857 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 856 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 840 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 763 | heterozygote | VUS3- Undef CF-causing- Undef |
| CBAVD | 765 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 781 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 805 | heterozygote | VUS3- Undef |
| CBAVD | 812 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 818 | heterozygote | |
| CBAVD | 941 | heterozygote | VUS4- Undef CF-causing- Undef |
| CBAVD | 978 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| CBAVD | 949 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 986 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CBAVD | 443 | homozygote | |
| CBAVD | 440 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans |
| CBAVD | 5129 | homozygote | c.1519_1521del - p.(Ile507del) - Trans c.1704G>T - p.(Leu568Phe) - Trans |
| CBAVD | 720 | homozygote | c.4097T>C - p.(Ile1366Thr) - Trans |
| CBAVD | 725 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| CBAVD | 504 | homozygote | c.3964-3890_*3143delinsTAACT - p.? - Trans c.509G>A - p.(Arg170His) - Trans |
| CBAVD | 908 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1466C>T - p.(Ser489Leu) - Trans c.1684G>A - p.(Val562Ile) - Trans |
| CBAVD | 5610 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans c.1521_1523del - p.(Phe508del) - Trans |
| CBAVD | 919 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans c.3846G>A - p.(Trp1282*) - Trans |
| CBAVD | 5343 | homozygote | c.2502T>G - p.(Phe834Leu) - Trans c.3718-79T>C - p.(=) - Trans |
| CBAVD | 396 | homozygote | |
| CBAVD | 881 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.617T>G - p.(Leu206Trp) - Trans |
| CBAVD | 5592 | homozygote | c.1210-34_1210-6TG[12]T[5] - Trans c.233dup - p.(Trp79Leufs*32) - Trans |
| CBAVD | 1132 | homozygote | c.3208C>T - p.(Arg1070Trp) - Trans c.509G>A - p.(Arg170His) - Trans |
| CBAVD | 525 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2991G>C - p.(Leu997Phe) - Trans |
| Pending (NBS) | 3042 | heterozygote | CF-causing - Cis varying clinical consequence - Trans |
| Pending (NBS) | 2964 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5017 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pending (NBS) | 4643 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Pending (NBS) | 4631 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending (NBS) | 4654 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 2520 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 4407 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4606 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pending (NBS) | 4508 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4645 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 6457 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5769 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Pending (NBS) | 5342 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 4694 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 387 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending (NBS) | 1070 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5190 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef varying clinical consequence- Undef |
| Pending (NBS) | 1076 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 5202 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS3- Undef |
| Pending (NBS) | 5247 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef CF-causing- Undef VUS1- Undef |
| Pending (NBS) | 4769 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 1547 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 1255 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending (NBS) | 1180 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 794 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 799 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pending (NBS) | 803 | heterozygote | VUS2- Undef CF-causing- Undef |
| Pending (NBS) | 991 | heterozygote | varying clinical consequence- Undef |
| Pending (NBS) | 4644 | homozygote | c.1209G>C - p.(Glu403Asp) - Trans c.2657+5G>A - p.(=) - Trans |
| Pending (NBS) | 5071 | homozygote | c.-288G>C - p.(=) - Trans c.2657+5G>A - p.(=) - Trans c.3139+89T>C - p.(=) - Trans |
| Pending (NBS) | 3676 | homozygote | c.1652G>A - p.(Gly551Asp) - Trans c.617T>G - p.(Leu206Trp) - Trans |
| Pending (NBS) | 5609 | homozygote | c.1070C>T - p.(Ala357Val) - Trans c.2988+1G>A - p.(=) - Trans |
| Pancreatitis | 3009 | heterozygote | CFTR-RD-causing - Cis VUS1 - Trans |
| Pancreatitis | 3016 | heterozygote | varying clinical consequence - Trans |
| Pancreatitis | 3023 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 3044 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 3061 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2919 | heterozygote | CFTR-RD-causing - Cis CFTR-RD-causing - Trans |
| Pancreatitis | 2978 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 3072 | heterozygote | CF-causing- Undef |
| Pancreatitis | 3259 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pancreatitis | 4619 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 3221 | heterozygote | |
| Pancreatitis | 2377 | heterozygote | CF-causing- Undef |
| Pancreatitis | 2408 | heterozygote | |
| Pancreatitis | 2414 | heterozygote | |
| Pancreatitis | 2417 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Pancreatitis | 2418 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2422 | heterozygote | |
| Pancreatitis | 2427 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2372 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2364 | heterozygote | |
| Pancreatitis | 2305 | heterozygote | VUS3- Undef |
| Pancreatitis | 2306 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2312 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2318 | heterozygote | |
| Pancreatitis | 2319 | heterozygote | |
| Pancreatitis | 2321 | heterozygote | |
| Pancreatitis | 2322 | heterozygote | |
| Pancreatitis | 2324 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2329 | heterozygote | VUS1- Undef |
| Pancreatitis | 2338 | heterozygote | VUS3- Undef |
| Pancreatitis | 2553 | heterozygote | CF-causing- Undef |
| Pancreatitis | 2591 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 2748 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2528 | heterozygote | |
| Pancreatitis | 2451 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2471 | heterozygote | VUS3- Undef non-CF- Undef |
| Pancreatitis | 2473 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 2483 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2486 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 2488 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 4659 | heterozygote | VUS3- Undef |
| Pancreatitis | 4296 | heterozygote | |
| Pancreatitis | 4299 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pancreatitis | 4301 | heterozygote | |
| Pancreatitis | 4240 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pancreatitis | 4250 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 4256 | heterozygote | |
| Pancreatitis | 4270 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Pancreatitis | 4581 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 4614 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
| Pancreatitis | 5977 | heterozygote | VUS3- Undef |
| Pancreatitis | 5974 | heterozygote | VUS3- Undef |
| Pancreatitis | 5010 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Pancreatitis | 5336 | heterozygote | VUS3- Undef VUS3- Undef |
| Pancreatitis | 5340 | heterozygote | VUS3- Undef |
| Pancreatitis | 5160 | heterozygote | CF-causing- Undef varying clinical consequence- Undef VUS3- Undef |
| Pancreatitis | 5621 | heterozygote | |
| Pancreatitis | 5364 | heterozygote | VUS3- Undef |
| Pancreatitis | 5605 | heterozygote | VUS2- Undef |
| Pancreatitis | 5611 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 5614 | heterozygote | VUS3- Undef |
| Pancreatitis | 5617 | heterozygote | VUS3- Undef |
| Pancreatitis | 5619 | heterozygote | non-CF- Undef |
| Pancreatitis | 669 | heterozygote | CF-causing- Undef |
| Pancreatitis | 648 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 4708 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Pancreatitis | 1524 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Pancreatitis | 2285 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 1161 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pancreatitis | 1063 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 4725 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Bronchiectasis | 4726 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 693 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef VUS3- Undef |
| Bronchiectasis | 1096 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 4870 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Bronchiectasis | 2287 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 2289 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2291 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2367 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2409 | heterozygote | CF-causing- Undef VUS3- Undef |
| Bronchiectasis | 2419 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Bronchiectasis | 2420 | heterozygote | CF-causing- Undef |
| Bronchiectasis | 2424 | heterozygote | |
| Bronchiectasis | 2446 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 2533 | heterozygote | CFTR-RD-causing- Undef |
| Bronchiectasis | 2960 | heterozygote | CFTR-RD-causing - Trans |
| Bronchiectasis | 2988 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef CF-causing- Undef |
| Bronchiectasis | 3038 | heterozygote | CFTR-RD-causing - Cis |
| Bronchiectasis | 3085 | heterozygote | non-CF- Undef |
| Bronchiectasis | 4657 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5972 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 6435 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5624 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| Bronchiectasis | 5589 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
| Bronchiectasis | 4242 | heterozygote | CF-causing- Undef |
| Bronchiectasis | 4253 | heterozygote | |
| Bronchiectasis | 4308 | heterozygote | |
| Bronchiectasis | 4474 | heterozygote | varying clinical consequence- Undef |
| Bronchiectasis | 4602 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Bronchiectasis | 5074 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans |
| Bronchiectasis | 5076 | homozygote | c.2658-77T>A - p.(=) - Trans |
| Bronchiectasis | 777 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.1684G>A - p.(Val562Ile) - Trans |
| Bronchiectasis | 966 | homozygote | c.1585-9418T>C - p.(=) - Trans c.899C>A - p.(Ala300Asp) - Trans |
| Bronchiectasis | 5126 | homozygote | c.1327G>T - p.(Asp443Tyr) - Trans |
| Asymptomatic compound heterozygote | 5073 | heterozygote | |
| Asymptomatic compound heterozygote | 5081 | heterozygote | |
| Asymptomatic compound heterozygote | 5077 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 558 | heterozygote | CF-causing- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 5220 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Asymptomatic compound heterozygote | 5141 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 5140 | heterozygote | VUS3- Undef CF-causing- Undef |
| Asymptomatic compound heterozygote | 5133 | heterozygote | VUS3- Undef |
| Asymptomatic compound heterozygote | 1083 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 1290 | heterozygote | CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 2863 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 3235 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4628 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4617 | heterozygote | VUS3 - Cis CF-causing - Trans |
| Asymptomatic compound heterozygote | 4763 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 6434 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 6437 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 5601 | heterozygote | CF-causing- Undef |
| Asymptomatic compound heterozygote | 5602 | heterozygote | VUS3- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 5606 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef CF-causing- Undef |
| Asymptomatic compound heterozygote | 5964 | heterozygote | VUS3- Undef CF-causing- Undef |
| Asymptomatic compound heterozygote | 4260 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4285 | heterozygote | CFTR-RD-causing - Cis VUS2 - Trans |
| Asymptomatic compound heterozygote | 4303 | heterozygote | CFTR-RD-causing- Undef |
| Asymptomatic compound heterozygote | 4522 | heterozygote | CF-causing- Undef VUS3- Undef |
| Asymptomatic compound heterozygote | 4523 | heterozygote | varying clinical consequence- Undef |
| Asymptomatic compound heterozygote | 4526 | heterozygote | VUS1- Undef |
| Asymptomatic compound heterozygote | 5745 | homozygote | c.1210-34_1210-6TG[11]T[5] - Trans c.3256A>G - p.(Thr1086Ala) - Trans |
| Asymptomatic compound heterozygote | 4741 | homozygote | c.489+3A>G - p.(=) - Trans |
| Asymptomatic compound heterozygote | 5362 | homozygote | c.1696G>A - p.(Ala566Thr) - Trans c.2743G>C - p.(Val915Leu) - Trans |
| Pending | 243 | heterozygote | |
| Pending | 312 | heterozygote | CFTR-RD-causing- Undef |
| Pending | 1097 | heterozygote | varying clinical consequence - Cis VUS3 - Trans |
| Pending | 3073 | heterozygote | CF-causing- Undef VUS3- Undef |
| Pending | 3165 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Pending | 5008 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
| Pending non-CF | 4825 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
| Pending non-CF | 3094 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
| Pending non-CF | 5009 | heterozygote | VUS3- Undef CF-causing- Undef |
| Pending non-CF | 4515 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
| CRS-NP | 5138 | heterozygote | non-CF- Undef |
| CRS-NP | 5531 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef VUS3- Undef |
| CRS-NP | 3078 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
| CRS-NP | 3126 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
| CRS-NP | 3161 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
| CRS-NP | 4276 | heterozygote | CFTR-RD-causing- Undef |
| CRS-NP | 4805 | heterozygote | |
| Aquagenic palmoplantar keratoderma | 5822 | heterozygote | CFTR-RD-causing- Undef non-CF- Undef |
| Aquagenic palmoplantar keratoderma | 5613 | heterozygote | non-CF- Undef |
| Aquagenic palmoplantar keratoderma | 4660 | homozygote | c.2657+5G>A - p.(=) - Trans |
| Aquagenic palmoplantar keratoderma | 5772 | homozygote | c.4139C>T - p.(Thr1380Ile) - Trans |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|