Variant NM_000492.4:c.443T>C


Variant details:
Name NM_000492.4:c.443T>C
Protein name NP_000483.3:p.(Ile148Thr)
Genomic name (hg19) chr7:g.117171122T>C    UCSC    
#Exon/intron exon 4
Legacy Name I148T
Class non disease-causing
complex allele in 23.53% of patients associated with
  • c.3067_3072del - p.(Ile1023_Val1024del) : 100.00%
    • WT sequence CCAGCCATTTTTGGCCTTCATCACA T TGGAATGCAGATGAGAATAGCTATG
    Mutant sequence CCAGCCATTTTTGGCCTTCATCACA C TGGAATGCAGATGAGAATAGCTATG

    Other databases:
    dbSNP
    rs35516286



    Pathogenicity predictors:

    Functional studies:


    Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
    Seibert et al, 1997 9305991 ✓ ✓ ✓
    Caputo et al, 2009 19491324 ✓ ✓
    Sosnay et al, 2013 23974870 ✓ ✓


    « ✓ » indicates the type of analysis performed and not the results


    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVA yesnoyesno
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    No patient found in CFTR-NGS catalogue


    17 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 17
    Asymptomatic compound heterozygote 1
    CF 8
    CFTR-RD7
    • Bronchiectasis  3
    • CRS-NP  1
    • Other  2
    • Pancreatitis  1
    Pending 1




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    CF 12heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 4386heterozygotelikely CFTR-RD- Undef
    CF 2789heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 2177heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 5366heterozygoteCF-causing- Undef
    CF-causing- Undef
    CF 1553heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 293heterozygoteCF-causing - Cis
    CF-causing - Trans
    CF 4465heterozygoteCF-causing - Cis
    CF-causing - Trans
    Other 4884heterozygoteCF-causing- Undef
    likely CFTR-RD- Undef
    Other 940heterozygoteCF-causing- Undef
    Bronchiectasis 2127heterozygoteCF-causing- Undef
    Bronchiectasis 1905heterozygoteCF-causing- Undef
    likely CFTR-RD- Undef
    Bronchiectasis 5062heterozygotevarying clinical consequence - Trans
    CF-causing- Undef
    Pancreatitis 1945heterozygotenon-CF- Undef
    Pending 3073heterozygoteCF-causing - Cis
    CFTR-RD-causing - Trans
    CFTR-RD-causing - Trans
    CFTR-RD-causing - Trans
    CRS-NP 3143heterozygoteCF-causing - Cis
    CFTR-RD-causing - Trans
    CFTR-RD-causing - Trans
    CFTR-RD-causing - Trans
    Asymptomatic compound heterozygote 3156heterozygoteCF-causing - Cis
    CFTR-RD-causing - Trans
    CFTR-RD-causing - Trans
    CFTR-RD-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare