Variant NM_000492.4:c.601G>A


Variant details:
Name NM_000492.4:c.601G>A
Protein name NP_000483.3:p.(Val201Met)
Genomic name (hg19) chr7:g.117175323G>A    UCSC    
#Exon/intron exon 6
Legacy Name V201M
Class likely benign
complex allele in 72.55% of patients associated with
  • c.220C>T - p.(Arg74Trp) : 100.00%
  • c.3808G>A - p.(Asp1270Asn) : 97.30%
    • WT sequence CCAGGGACTTGCATTGGCACATTTC G TGTGGATCGCTCCTTTGCAAGTGGC
    Mutant sequence CCAGGGACTTGCATTGGCACATTTC A TGTGGATCGCTCCTTTGCAAGTGGC


    Effects of associated complex alleles:
    R74W non disease-causing
    D1270N non disease-causing
    R74W ; D1270N non disease-causing
    R74W ; V201M ; D1270N disease-causing - CFTR-RD-causing




    Other databases:
    dbSNP
    rs138338446



    Pathogenicity predictors:



    Response to modulators:


    Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
    IVAnononono
    TEZ-IVA yesnoyesno
    ELX-TEZ-IVA yesnoyesno


    clinical and functional data are provided by Vertex


    1 individuals carrying this variant are reported in CFTR-NGS catalogue


    51 patients carrying this variant are reported in CFTR-France:

    TOTAL NUMBER OF PATIENTS 51
    Asymptomatic compound heterozygote 3
    CF 3
    CFTR-RD37
    • Aquagenic palmoplantar keratoderma  1
    • CBAVD  25
    • CRS-NP  1
    • Other  4
    • Pancreatitis  6
    Pending 2
    Pending (NBS) 6




    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

    Detailed genotypes:
    Phenotype Patient ID Variant status Additional variants
    Other 3138heterozygote
    Other 5383heterozygoteCF-causing - Trans
    Other 5075heterozygoteCF-causing - Trans
    Other 4702heterozygoteCF-causing - Trans
    CBAVD 2347heterozygoteCFTR-RD-causing- Undef
    CBAVD 6222heterozygoteCF-causing - Trans
    CBAVD 5875heterozygoteCF-causing- Undef
    CBAVD 5872heterozygoteCFTR-RD-causing- Undef
    CBAVD 5866heterozygoteCF-causing- Undef
    CBAVD 4556heterozygoteCF-causing- Undef
    CBAVD 4224heterozygoteVUS2 - Trans
    CBAVD 3324heterozygoteCF-causing - Trans
    CBAVD 3208heterozygoteCF-causing- Undef
    CBAVD 892heterozygotevarying clinical consequence- Undef
    CBAVD 751heterozygoteCF-causing - Trans
    CBAVD 697heterozygotevarying clinical consequence - Trans
    CBAVD 565heterozygoteVUS3- Undef
    VUS1- Undef
    CBAVD 543heterozygoteCF-causing - Trans
    CBAVD 503heterozygoteCFTR-RD-causing- Undef
    CBAVD 4956heterozygotevarying clinical consequence- Undef
    CBAVD 5223heterozygoteCF-causing- Undef
    CBAVD 1456heterozygote
    CBAVD 1412heterozygotevarying clinical consequence- Undef
    CBAVD 1366heterozygoteCF-causing- Undef
    CBAVD 1294heterozygoteCFTR-RD-causing- Undef
    CBAVD 1269heterozygoteCF-causing- Undef
    CBAVD 5519heterozygoteCF-causing- Undef
    CBAVD 660homozygotec.601G>A - p.(Val201Met) - Trans
    CBAVD 507homozygotec.601G>A - p.(Val201Met) - Trans
    CF 5285heterozygoteCF-causing - Trans
    CF 382heterozygoteVUS3 - Cis
    CF-causing - Trans
    CF 5059heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3156heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 3794heterozygoteCF-causing - Trans
    Asymptomatic compound heterozygote 782homozygotec.601G>A - p.(Val201Met) - Trans
    Pending (NBS) 6090heterozygoteCF-causing- Undef
    Pending (NBS) 5703heterozygoteVUS3 - Cis
    CF-causing - Trans
    Pending (NBS) 5446heterozygoteCF-causing - Trans
    Pending (NBS) 4593heterozygoteCF-causing - Trans
    Pending (NBS) 5313heterozygoteCF-causing - Trans
    Pending (NBS) 5853heterozygoteCF-causing - Trans
    Aquagenic palmoplantar keratoderma 5470heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2242heterozygoteCFTR-RD-causing- Undef
    Pancreatitis 2137heterozygoteCF-causing- Undef
    Pancreatitis 5623heterozygoteCFTR-RD-causing - Trans
    Pancreatitis 5620heterozygote
    Pancreatitis 5396heterozygoteCF-causing - Trans
    Pancreatitis 1821heterozygote
    Pending 3073heterozygoteCF-causing - Trans
    Pending 4337heterozygoteCF-causing - Trans
    CRS-NP 3143heterozygoteCF-causing - Trans


    Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



                CFTR variants are clustered into five groups:
    • CF-causing: when in trans with another CF-causing mutation, will result in CF.
    • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
    • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
    • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
    • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



    Go to CFTRare