| 2022-07-26 | Class updated from VUS to disease_causing, CFTR-RD-causing |
| 2024-10-14 | Class updated from CFTR-RD-causing to likely benign |
| 2024-12-09 | Variant classified as likely benign on the basis of epidemiological data (in particular high frequency in the general population), the number and type of diagnosis for patients reported in CFTR-France and functional data |
Variant NM_000492.4:c.601G>A
| Name | NM_000492.4:c.601G>A | ||||
| Protein name | NP_000483.3:p.(Val201Met) | ||||
| Genomic name (hg19) | chr7:g.117175323G>A UCSC | ||||
| Genomic name (hg38) | chr7:g.117535269G>A UCSC | ||||
| #Exon/intron | exon 6 | ||||
| Legacy Name | V201M | ||||
| Class | likely benign | ||||
complex allele in 68.52% of patients associated with | WT sequence |
CCAGGGACTTGCATTGGCACATTTC G TGTGGATCGCTCCTTTGCAAGTGGC |
Mutant sequence |
CCAGGGACTTGCATTGGCACATTTC A TGTGGATCGCTCCTTTGCAAGTGGC |
|
| R74W | non disease-causing |
| D1270N | non disease-causing |
| R74W ; D1270N | non disease-causing |
| R74W ; V201M ; D1270N | disease-causing - CFTR-RD-causing |
![]() |
![]() | dbSNP rs138338446 |
![]() | ![]() |
| Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
| IVA | no | no | no | no |
| TEZ-IVA | yes | no | yes | no |
| ELX-TEZ-IVA | yes | no | yes | no |
| VNZ-TEZ-DIVA | yes | no | yes | no |
clinical and functional data presented above are provided by Vertex
1 individuals carrying this variant are reported in CFTR-NGS catalogue |
| TOTAL NUMBER OF PATIENTS | 54 |
|---|---|
| Asymptomatic compound heterozygote | 3 |
| CF | 3 |
| CFTR-RD | 40
|
| Pending | 2 |
| Pending (NBS) | 6 |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| Phenotype | Patient ID | Variant status | Additional variants |
|---|---|---|---|
| Other | 6474 | heterozygote | CF-causing- Undef |
| Other | 3138 | heterozygote | |
| Other | 5075 | heterozygote | CF-causing - Trans |
| Other | 5383 | heterozygote | CF-causing - Trans |
| Other | 4702 | heterozygote | CF-causing - Trans |
| CBAVD | 2347 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 6222 | heterozygote | CF-causing - Trans |
| CBAVD | 5875 | heterozygote | CF-causing- Undef |
| CBAVD | 5872 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 5866 | heterozygote | CF-causing- Undef |
| CBAVD | 3208 | heterozygote | CF-causing- Undef |
| CBAVD | 6473 | heterozygote | varying clinical consequence- Undef |
| CBAVD | 4556 | heterozygote | CF-causing- Undef |
| CBAVD | 4224 | heterozygote | VUS2 - Trans |
| CBAVD | 3324 | heterozygote | CF-causing - Trans |
| CBAVD | 5223 | heterozygote | CF-causing- Undef |
| CBAVD | 892 | heterozygote | varying clinical consequence- Undef |
| CBAVD | 751 | heterozygote | CF-causing - Trans |
| CBAVD | 697 | heterozygote | varying clinical consequence - Trans |
| CBAVD | 565 | heterozygote | VUS3- Undef VUS1- Undef |
| CBAVD | 543 | heterozygote | CF-causing - Trans |
| CBAVD | 503 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 4956 | heterozygote | varying clinical consequence- Undef |
| CBAVD | 5519 | heterozygote | CF-causing- Undef |
| CBAVD | 1456 | heterozygote | |
| CBAVD | 1412 | heterozygote | varying clinical consequence- Undef |
| CBAVD | 1366 | heterozygote | CF-causing- Undef |
| CBAVD | 1294 | heterozygote | CFTR-RD-causing- Undef |
| CBAVD | 1269 | heterozygote | CF-causing- Undef |
| CBAVD | 660 | homozygote | c.601G>A - p.(Val201Met) - Trans |
| CBAVD | 507 | homozygote | c.601G>A - p.(Val201Met) - Trans |
| CF | 382 | heterozygote | VUS3 - Cis CF-causing - Trans |
| CF | 5285 | heterozygote | CF-causing - Trans |
| CF | 5059 | heterozygote | CF-causing - Trans |
| Asymptomatic compound heterozygote | 3156 | heterozygote | CF-causing - Trans |
| Asymptomatic compound heterozygote | 3794 | heterozygote | CF-causing - Trans |
| Asymptomatic compound heterozygote | 782 | homozygote | c.601G>A - p.(Val201Met) - Trans |
| Pending (NBS) | 5703 | heterozygote | VUS3 - Cis CF-causing - Trans |
| Pending (NBS) | 6090 | heterozygote | CF-causing- Undef |
| Pending (NBS) | 4593 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 5313 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 5446 | heterozygote | CF-causing - Trans |
| Pending (NBS) | 5853 | heterozygote | CF-causing - Trans |
| Aquagenic palmoplantar keratoderma | 5470 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2242 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 2137 | heterozygote | CF-causing- Undef |
| Pancreatitis | 6429 | heterozygote | CFTR-RD-causing- Undef |
| Pancreatitis | 5623 | heterozygote | CFTR-RD-causing - Trans |
| Pancreatitis | 5620 | heterozygote | |
| Pancreatitis | 5396 | heterozygote | CF-causing - Trans |
| Pancreatitis | 1821 | heterozygote | |
| Pending | 3073 | heterozygote | CF-causing - Trans |
| Pending | 4337 | heterozygote | CF-causing - Trans |
| CRS-NP | 3143 | heterozygote | CF-causing - Trans |
| Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
| CFTR variants are clustered into five groups (click here for more details about the classification of variants): |
|