Variant NM_000492.4:c.617T>G
Name | NM_000492.4:c.617T>G | ||||
Protein name | NP_000483.3:p.(Leu206Trp) | ||||
Genomic name (hg19) | chr7:g.117175339T>G UCSC | ||||
#Exon/intron | exon 6 | ||||
Legacy Name | L206W | ||||
Class | disease-causing | ||||
Subclass | varying clinical consequence | ||||
complex allele in 5.15% of patients associated with WT sequence |
GCACATTTCGTGTGGATCGCTCCTT T GCAAGTGGCACTCCTCATGGGGCTA |
Mutant sequence |
GCACATTTCGTGTGGATCGCTCCTT G GCAAGTGGCACTCCTCATGGGGCTA |
|
![]() |
![]() | dbSNP rs121908752 |
![]() | ![]() |
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | no | yes |
TEZ-IVA | yes | yes | no | yes |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
No patient found in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 136 |
---|---|
Asymptomatic compound heterozygote | 3 |
CF | 28 |
CFTR-RD | 71
|
Pending | 2 |
Pending (NBS) | 29 |
Pending non-CF | 3 |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CF | 4899 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 2655 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 2827 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 3223 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 2253 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5863 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 2016 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 2109 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 2197 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 6096 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 6202 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 4485 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 5622 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 3917 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 4390 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 4464 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 4479 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 38 | heterozygote | varying clinical consequence - Cis VUS3 - Trans |
CF | 821 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 822 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 90 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 263 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 277 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 280 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 381 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 1693 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CF | 5132 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CF | 4782 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Other | 4528 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Other | 4676 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Other | 5813 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Other | 6357 | heterozygote | varying clinical consequence - Cis CFTR-RD-causing - Trans |
Other | 4783 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Other | 4800 | heterozygote | VUS3- Undef CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
Other | 5184 | heterozygote | varying clinical consequence - Cis CF-causing - Trans VUS3- Undef VUS3- Undef |
CBAVD | 5375 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 4935 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 4937 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 2631 | heterozygote | varying clinical consequence - Cis VUS3- Undef CF-causing- Undef |
CBAVD | 2817 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 3353 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 3374 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 4877 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 5459 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
CBAVD | 1930 | heterozygote | CF-causing- Undef VUS3- Undef varying clinical consequence- Undef |
CBAVD | 2203 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 3381 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 3414 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
CBAVD | 4592 | heterozygote | varying clinical consequence - Cis CFTR-RD-causing - Trans |
CBAVD | 4597 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 6173 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 5594 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 548 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 614 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 643 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 765 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 834 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 840 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 857 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 881 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 912 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 491 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 490 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 4679 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 4837 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 422 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 434 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 978 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CBAVD | 1163 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 1329 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 1363 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 1412 | heterozygote | VUS3- Undef varying clinical consequence- Undef |
CBAVD | 1413 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 1438 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CBAVD | 1442 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 1463 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 1679 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
CBAVD | 1748 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 5221 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
CBAVD | 1052 | heterozygote | varying clinical consequence- Undef varying clinical consequence- Undef |
CBAVD | 1056 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending | 4680 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending | 6309 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending non-CF | 4681 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending non-CF | 4677 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending non-CF | 4515 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
Bronchiectasis | 6405 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 2055 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 4602 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 4488 | heterozygote | varying clinical consequence - Cis |
Bronchiectasis | 850 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Bronchiectasis | 4726 | heterozygote | varying clinical consequence - Cis CFTR-RD-causing- Undef |
Bronchiectasis | 962 | heterozygote | VUS2 - Cis varying clinical consequence - Cis CF-causing - Trans |
Bronchiectasis | 1096 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Bronchiectasis | 6344 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 2964 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 3118 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 4654 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 5443 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 6095 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 6185 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 6001 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 6100 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 6008 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5342 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 3655 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 3676 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 3884 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 4228 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 4266 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 4407 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 6011 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 590 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 794 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 799 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 4821 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 1076 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 1180 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 1547 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 5190 | heterozygote | CF-causing- Undef VUS3- Undef VUS3- Undef varying clinical consequence- Undef |
Pending (NBS) | 1064 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 5852 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pending (NBS) | 4769 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5046 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
Asymptomatic compound heterozygote | 5376 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Asymptomatic compound heterozygote | 6195 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 5744 | heterozygote | VUS2- Undef varying clinical consequence- Undef |
Pancreatitis | 2623 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pancreatitis | 3259 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
Pancreatitis | 5452 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pancreatitis | 5864 | heterozygote | varying clinical consequence - Cis |
Pancreatitis | 1960 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pancreatitis | 2067 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Pancreatitis | 4270 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
Pancreatitis | 1063 | heterozygote | varying clinical consequence - Cis CF-causing - Trans |
CRS-NP | 6196 | heterozygote | CF-causing- Undef varying clinical consequence- Undef |
Color code: non disease-causing < likely benign < VUS < likely pathogenic < disease-causing |
CFTR variants are clustered into five groups: |
|