Variant NM_000492.4:c.743+40A>G


Variant details:
Name NM_000492.4:c.743+40A>G
Protein name NP_000483.3:p.(=)
Genomic name (hg19)     chr7:g.117175505A>G    UCSC    
Genomic name (hg38) chr7:g.117535451A>G    UCSC
#Exon/intron intron 6
Legacy Name 875+40A/G
Class non disease-causing
WT sequence TCATAACTTGAAAGTTTTAAAAATT A TGTTTTCAAAAAGCCCACTTTAGTA
Mutant sequence TCATAACTTGAAAGTTTTAAAAATT G TGTTTTCAAAAAGCCCACTTTAGTA

Other databases:

Not found		dbSNP
rs1800502







Pathogenicity predictors:

Not found




23 individuals carrying this variant are reported in CFTR-NGS catalogue


100 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 100
Asymptomatic compound heterozygote 9
CF 35
CFTR-RD54
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  7
  • CBAVD  28
  • CRS-NP  1
  • Other  11
  • Pancreatitis  6
Pending (NBS) 2




Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing

Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 5069heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 1289heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1293heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 1517heterozygoteVUS3- Undef
CF-causing- Undef
CF-causing- Undef
CF 1528heterozygote
CF 1535heterozygoteCF-causing - Cis
CFTR-RD-causing - Cis
CF-causing - Trans
CF 1584heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4538heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 4553heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5341heterozygoteVUS3- Undef
CF-causing- Undef
CF 5777heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 3476heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3575heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4043heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5807heterozygoteCF-causing- Undef
CF-causing- Undef
CF 247heterozygoteVUS3- Undef
CF-causing- Undef
CF 379heterozygoteCF-causing- Undef
CF-causing- Undef
CF 270heterozygoteCF-causing- Undef
CF-causing- Undef
CF 232heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 111heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 138heterozygoteCF-causing - Cis
CF-causing - Trans
CF 143heterozygoteCF-causing- Undef
CF-causing- Undef
CF 145heterozygoteCF-causing - Cis
CF-causing - Trans
CF 169heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 204heterozygoteVUS3- Undef
CF-causing- Undef
CF-causing- Undef
CF 985heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1005heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1006heterozygoteCF-causing - Cis
CF-causing - Trans
CF 5215heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF 882heterozygoteCF-causing- Undef
CF-causing- Undef
CF 28homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 129homozygotec.3883_3886del - p.(Ile1295Phefs*32) - Trans
CF 136homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 26homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 112homozygotec.3883_3886del - p.(Ile1295Phefs*32) - Trans
Other 5224heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 4627heterozygoteCFTR-RD-causing- Undef
Other 1089heterozygotevarying clinical consequence - Trans
Other 5575heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 6438heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Other 4315heterozygotevarying clinical consequence- Undef
Other 4520heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4686heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 5082heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 4826heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4694heterozygoteCF-causing- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pancreatitis 4619heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 4849heterozygoteCF-causing - Cis
CF-causing - Trans
Pancreatitis 4250heterozygoteCFTR-RD-causing- Undef
Pancreatitis 5155heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 4581heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4708heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 5972heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 6435heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4550heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4242heterozygoteCF-causing- Undef
Bronchiectasis 5624heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5076heterozygoteVUS3- Undef
Bronchiectasis 4870homozygotec.1054C>T - p.(Arg352Trp) - Trans
c.1210-34_1210-6TG[11]T[5] - Trans
c.1210-34_1210-6TG[12]T[5] - Trans
CBAVD 3388heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5330heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5022heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 1276heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4271heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4524heterozygoteCF-causing- Undef
likely CFTR-RD- Undef
CBAVD 5768heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 396heterozygote
CBAVD 416heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 436heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 445heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 453heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 443heterozygote
CBAVD 455heterozygoteCFTR-RD-causing- Undef
CBAVD 462heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 919heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
CBAVD 812heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 949heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 881heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 529heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 676heterozygoteCFTR-RD-causing- Undef
CBAVD 503heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 484heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 725heterozygoteCFTR-RD-causing- Undef
non-CF- Undef
CF-causing- Undef
CBAVD 781heterozygoteCFTR-RD-causing- Undef
CBAVD 440homozygotec.1210-34_1210-6TG[11]T[5] - Trans
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
Asymptomatic compound heterozygote 4741heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 6434heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 3235heterozygoteCFTR-RD-causing - Cis
CFTR-RD-causing - Trans
Asymptomatic compound heterozygote 6437heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 4375heterozygoteCF-causing- Undef
VUS2- Undef
Asymptomatic compound heterozygote 4523heterozygotevarying clinical consequence- Undef
Asymptomatic compound heterozygote 5362heterozygoteVUS3- Undef
VUS3- Undef
Aquagenic palmoplantar keratoderma 5149heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CRS-NP 4276heterozygoteCFTR-RD-causing- Undef


Color code:   non disease-causing <   likely benign <   VUS <   likely pathogenic <   disease-causing



            CFTR variants are clustered into five groups (click here for more details about the classification of variants):
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare